si:ch1073-183g13.2

Ensembl ID:
ENSDARG00000061233
ZFIN ID:
ZDB-GENE-030131-8091
Description:
multidrug resistance-associated protein 5 [Source:RefSeq peptide;Acc:NP_001182542]
Mouse Orthologue:
Abcc5
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 5 Gene [Source:MGI Symbol;Acc:MGI:1351644]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43168 Nonsense Mutation detected in F1 DNA During 2017
sa43169 Nonsense Mutation detected in F1 DNA During 2017
sa31027 Nonsense Mutation detected in F1 DNA During 2017
sa43170 Nonsense Mutation detected in F1 DNA During 2017
sa2950 Nonsense F2 line generated During 2017
sa32218 Nonsense Available for shipment Available now
sa43171 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087070 Nonsense 150 1426 4 28
ENSDART00000135045 Nonsense 150 241 5 5

The following transcripts of ENSDARG00000061233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 44227527)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45816582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATAATAATACAACTCCTGCATTTCAACAGGCTGGCGGGACTGTGGGAA[G/T]AAGAAATCAGGTCACGAGGAGACGACGCGTCTCTTCGTCGTGTGGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087070 Nonsense 155 1426 4 28
ENSDART00000135045 Nonsense 155 241 5 5
ENSDART00000087070 Nonsense 155 1426 4 28
ENSDART00000135045 Nonsense 155 241 5 5

The following transcripts of ENSDARG00000061233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 44227542)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45816597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCATTTCAACAGGCTGGCGGGACTGTGGGAAGAAGAAATCAGGTCA[C/T]GAGGAGACGACGCGTCTCTTCGTCGTGTGGTCTGGCATTTTTGCCGCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087070 Nonsense 155 1426 4 28
ENSDART00000135045 Nonsense 155 241 5 5
ENSDART00000087070 Nonsense 155 1426 4 28
ENSDART00000135045 Nonsense 155 241 5 5

The following transcripts of ENSDARG00000061233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 44227542)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45816597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCATTTCAACAGGCTGGCGGGACTGTGGGAAGAAGAAATCAGGTCA[C/T]GAGGAGACGACGCGTCTCTTCGTCGTGTGGTCTGGCATTTTTGCCGCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087070 Nonsense 373 1426 7 28
ENSDART00000135045   None 241 None 5

The following transcripts of ENSDARG00000061233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 44235682)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45824513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACTACATCAAATTCATTAAGATGTACGCCTGGGTTAAGGCTTTCTCA[C/T]AAGCTGTCAGAAGTAAGTTGCTGTCTTTTGTATTGATTTGAATGCTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2950
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087070 Nonsense 391 1426 8 28
ENSDART00000135045   None 241 None 5

The following transcripts of ENSDARG00000061233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 44236825)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45825656
KASP Assay ID:
554-2562.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACAGGAATAAGAGATGAGGAGCGGCAGATCCTGGAACGAACAGGGTA[T/G]TTTCAGAGCATYACAGTTGGCGTGGCACCTATCGTGGTGGTGATCGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087070 Nonsense 1066 1426 21 28
ENSDART00000135045   None 241 None 5

The following transcripts of ENSDARG00000061233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 44255827)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45844658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGAAAAGACCTCCAGTGCTAGATTTTGTCTGTCTTCTGCTGCAGGTA[T/G]CAGGAGTTGCTGGATCAGAATCAGGCTCCTTTCTATCTGTTCAGCTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087070 Essential Splice Site 1158 1426 23 28
ENSDART00000135045   None 241 None 5

The following transcripts of ENSDARG00000061233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 44257720)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45846551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTAGATGGGTTGAGAACAGAGAAGGTGACATTCAGTTTTTTTGTCTCA[G/A]TCTCTGTCTTTGGAGGCTCCAGCGCGGGTGAAGAACAAGGCTCCTCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link