ogfrl1

Ensembl ID:
ENSDARG00000061223
ZFIN ID:
ZDB-GENE-061207-32
Description:
Novel protein similar to human opioid growth factor receptor-like 1 (OGFRL1) [Source:UniProtKB/TrEMB
Human Orthologue:
OGFRL1
Human Description:
opioid growth factor receptor-like 1 [Source:HGNC Symbol;Acc:21378]
Mouse Orthologue:
Ogfrl1
Mouse Description:
opioid growth factor receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:1917405]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087097 Nonsense 195 382 6 7
ENSDART00000139081 Nonsense 166 353 5 6
Genomic Location (Zv9):
Chromosome 13 (position 28129015)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27774963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACGATTCCTCCTGGCATATACAATCATGCTGGATTTCTTTGGAATC[A/T]AACTCCTGGATAAAAACGGAAATGTATCTCGAGCTTCAAATTGGCAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link