
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC100001302
- Ensembl ID:
- ENSDARG00000061222
- Human Orthologue:
- UBA7
- Human Description:
- ubiquitin-like modifier activating enzyme 7 [Source:HGNC Symbol;Acc:12471]
- Mouse Orthologue:
- Uba7
- Mouse Description:
- ubiquitin-like modifier activating enzyme 7 Gene [Source:MGI Symbol;Acc:MGI:1349462]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16823 | Essential Splice Site | Available for shipment | Available now |
sa16325 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16823
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087080 | Essential Splice Site | 152 | 1016 | 4 | 24 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52905718)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52954723 GRCz11 6 52953052 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACTCAAACAATATAAAGTTTATTGTGGCTGACACCAGAGGACTYTGTGG[G/A]TAAGAAGCATCWCATGAATCAATACAMCACATCAATATTTATAGCGGTRC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16325
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087080 | Nonsense | 541 | 1016 | 14 | 24 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52918003)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52967008 GRCz11 6 52965337 - KASP Assay ID:
- 2259-8205.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACTTAACTAGCTGTCTTAACTTTTATTTTCCTTGTCCATTAGGGGTTTA[T/A]CTTGACCAATGTTGTGTGCGAAASAAAAAGCCCATGCTGGAGGGAGGAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: