LOC100001302

Ensembl ID:: ENSDARG00000061222
Human Orthologue:: UBA7
Human Description:: ubiquitin-like modifier activating enzyme 7 [Source:HGNC Symbol;Acc:12471]
Mouse Orthologue:: Uba7
Mouse Description:: ubiquitin-like modifier activating enzyme 7 Gene [Source:MGI Symbol;Acc:MGI:1349462]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa16823	Essential Splice Site	Available for shipment	Available now
sa16325	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa16823
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000087080	Essential Splice Site	152	1016	4	24

Genomic Location:: Chromosome 6 (position 52905718)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CACTCAAACAATATAAAGTTTATTGTGGCTGACACCAGAGGACTYTGTGG[G/A]TAAGAAGCATCWCATGAATCAATACAMCACATCAATATTTATAGCGGTRC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa16325
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000087080	Nonsense	541	1016	14	24

Genomic Location:: Chromosome 6 (position 52918003)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AACTTAACTAGCTGTCTTAACTTTTATTTTCCTTGTCCATTAGGGGTTTA[T/A]CTTGACCAATGTTGTGTGCGAAASAAAAAGCCCATGCTGGAGGGAGGAAC
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for UBA7

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: