postn

Ensembl ID:
ENSDARG00000061219
ZFIN ID:
ZDB-GENE-030131-9120
Description:
periostin isoform 2 [Source:RefSeq peptide;Acc:NP_981966]
Human Orthologue:
POSTN
Human Description:
periostin, osteoblast specific factor [Source:HGNC Symbol;Acc:16953]
Mouse Orthologue:
Postn
Mouse Description:
periostin, osteoblast specific factor Gene [Source:MGI Symbol;Acc:MGI:1926321]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18497 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017098 Essential Splice Site 762 780 19 20
ENSDART00000087071 Essential Splice Site 764 782 20 21
ENSDART00000130390   None 756 None 19
ENSDART00000132263   None 75 None 6
ENSDART00000135120   None 87 None 5
ENSDART00000139928 Essential Splice Site 235 253 10 11

The following transcripts of ENSDARG00000061219 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 33137456)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32879095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATAGTACCAACATGACTGACATTTTTGTCTTTTGATCCTCTGTTTCCA[A/G]GAGGGAACAAGAAGAGTGCCTCCAAGAAGAGTGCAAGGTAAATTTTAGRG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link