lipin2

Ensembl ID:
ENSDARG00000061214
ZFIN ID:
ZDB-GENE-060503-153
Description:
LOC558422 protein [Source:UniProtKB/TrEMBL;Acc:A8WGB6]
Human Orthologue:
LPIN2
Human Description:
lipin 2 [Source:HGNC Symbol;Acc:14450]
Mouse Orthologue:
Lpin2
Mouse Description:
lipin 2 Gene [Source:MGI Symbol;Acc:MGI:1891341]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18199 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085242 Nonsense 116 904 3 19
ENSDART00000141575 Nonsense 116 905 4 20
Genomic Location:
Chromosome 2 (position 30686423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCACACCTGGCCACCTCCCCCATTCCCACAGAGAGTCACTTATTTTG[G/A]ATCGGAGGCGAWCATAGGTCAAGKCAAAACCTGGACRATGAYCCACTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sma2hy9g