rab40c

Ensembl ID:
ENSDARG00000061208
ZFIN ID:
ZDB-GENE-030515-1
Description:
ras-related protein Rab-40C [Source:RefSeq peptide;Acc:NP_001035438]
Human Orthologue:
RAB40C
Human Description:
RAB40C, member RAS oncogene family [Source:HGNC Symbol;Acc:18285]
Mouse Orthologue:
Rab40c
Mouse Description:
Rab40c, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:2183454]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26065 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087047 Nonsense 241 279 6 6
Genomic Location (Zv9):
Chromosome 3 (position 26263631)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26623341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCATGGCGAACGGCATGAATGCTGTCATGATGCACGGCCGCTCGTA[T/G]TCGCTGGCCAATGCCGCCGGAGGCAGCAAAGGTAACAGTCTTAAACGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Disc degeneration (lumbar): Novel genetic variants associated with lumbar disc degeneration in northern Europeans: a meta-analysis of 4600 subjects. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link