ddx20

Ensembl ID:
ENSDARG00000061204
ZFIN ID:
ZDB-GENE-030131-202
Description:
Probable ATP-dependent RNA helicase DDX20 [Source:UniProtKB/Swiss-Prot;Acc:P0C218]
Human Orthologue:
DDX20
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 [Source:HGNC Symbol;Acc:2743]
Mouse Orthologue:
Ddx20
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 Gene [Source:MGI Symbol;Acc:MGI:1858415]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087037 Nonsense 168 789 3 11
ENSDART00000134226 Nonsense 168 788 4 12
ENSDART00000136973   None 106 None 3
Genomic Location (Zv9):
Chromosome 8 (position 29108591)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28236509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGGAGTGCCATGTGTTCATTGGTGGTCGACCTATCAGTCAAGATAAA[C/T]AGCAYCTGAAGAAGTGCCACATTGCTATTGGGTCACCAGGTATGAYCTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link