acsf2

Ensembl ID:
ENSDARG00000061201
ZFIN ID:
ZDB-GENE-060825-7
Description:
Acyl-CoA synthetase family member 2, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q0P4F7]
Human Orthologue:
ACSF2
Human Description:
acyl-CoA synthetase family member 2 [Source:HGNC Symbol;Acc:26101]
Mouse Orthologue:
Acsf2
Mouse Description:
acyl-CoA synthetase family member 2 Gene [Source:MGI Symbol;Acc:MGI:2388287]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22107 Nonsense Available for shipment Available now
sa38895 Nonsense Mutation detected in F1 DNA During 2016
sa31878 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087040 Nonsense 153 606 5 17
ENSDART00000132737 Nonsense 153 231 4 6
ENSDART00000138437   None 135 None 4
ENSDART00000143213 Nonsense 153 181 5 6

The following transcripts of ENSDARG00000061201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28103625)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26441234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGCTAAAGTGGATTGTGATTGAACAGGTTGCGGTGAACCCGGCTTAT[C/T]AATTGCAAGAGGTAGAATTTGCTCTCAGAAAGGTAAGTTAATGTTTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087040 Nonsense 235 606 7 17
ENSDART00000132737   None 231 None 6
ENSDART00000138437   None 135 None 4
ENSDART00000143213   None 181 None 6

The following transcripts of ENSDARG00000061201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28101209)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26438818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTTTCCTTTTGAAAGATCTGATGCAGGCAGGAAGCAGCCAACACTA[T/A]CAACAACTTCAAGACCTACAGAAGAAACTTGTTTGCGATGATCCCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087040 Nonsense 351 606 10 17
ENSDART00000132737   None 231 None 6
ENSDART00000138437   None 135 None 4
ENSDART00000143213   None 181 None 6

The following transcripts of ENSDARG00000061201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28097791)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26435400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAACTGTTTAACCAGGTGTACATTTGTCTACGGTACCCCCACTATGTA[T/A]ATCGACATGCTCGGACAGCCAGACCTGGCCAAGTTTGATTTGTCATCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link