acsf2

Ensembl ID:
ENSDARG00000061201
ZFIN ID:
ZDB-GENE-060825-7
Description:
Acyl-CoA synthetase family member 2, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q0P4F7]
Human Orthologue:
ACSF2
Human Description:
acyl-CoA synthetase family member 2 [Source:HGNC Symbol;Acc:26101]
Mouse Orthologue:
Acsf2
Mouse Description:
acyl-CoA synthetase family member 2 Gene [Source:MGI Symbol;Acc:MGI:2388287]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22107 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087040 Nonsense 153 606 5 17
ENSDART00000132737 Nonsense 153 231 4 6
ENSDART00000138437 None None 135 None 4
ENSDART00000143213 Nonsense 153 181 5 6

The following transcripts of ENSDARG00000061201 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 28103625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGCTAAAGTGGATTGTGATTGAACAGGTTGCGGTGAACCCGGCTTAT[C/T]AATTGCAAGAGGTAGAATTTGCTCTCAGAAAGGTAAGTTAATGTTTATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7r176mqx