emilin2a

Ensembl ID:
ENSDARG00000061196
ZFIN ID:
ZDB-GENE-060503-247
Human Orthologue:
EMILIN2
Human Description:
elastin microfibril interfacer 2 [Source:HGNC Symbol;Acc:19881]
Mouse Orthologue:
Emilin2
Mouse Description:
elastin microfibril interfacer 2 Gene [Source:MGI Symbol;Acc:MGI:2389136]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32947 Nonsense Mutation detected in F1 DNA During 2016
sa719 Essential Splice Site Available for shipment Available now
sa718 Essential Splice Site Available for shipment Available now
sa9754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Nonsense 41 1024 1 8
ENSDART00000140841 Nonsense 75 776 2 4
ENSDART00000148157   None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30732152)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31033787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACCTGAAGCCGCGCGCTGTCCTGAGCACCAGCCTGACTGTGAGCCA[C/T]AAATGATGTAAGTCCTCGAGAGACCGGGAGGGGCGTGTGGTGGAAACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Essential Splice Site 117 1024 2 8
ENSDART00000140841   None 776 None 4
ENSDART00000148157   None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30728306)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31029941
KASP Assay ID:
554-0627.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAACTGCACAAAGTATGGAATCTTTCACAATGATTGCATGTTRTTTCT[G/A]TATGTTCTAATGCATGTATTCATTTTTTAGGTTTAAATGATCTTAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Essential Splice Site 118 1024 3 8
ENSDART00000140841   None 776 None 4
ENSDART00000148157   None 155 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30728241)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31029876
KASP Assay ID:
554-0626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATTCATTTTTTAGGTTTAAATGATCTTAATGGTGATTTGTTTCTATA[C/T]GTTTCGTTACCACAGGACCAGAGCGGCGGGAAACTGTACAATATGACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087026 Nonsense 993 1024 8 8
ENSDART00000140841   None 776 None 4
ENSDART00000148157 Nonsense 124 155 2 2
Genomic Location (Zv9):
Chromosome 2 (position 30701925)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31003560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTCTTTCAGCCTCATYCTYCCKCTCCACAGAGGTGACACCRTGGCCT[T/A]GGTCCGCACTGCTGGTAAGCTGGCGGTCTCYGAATCAAGAGAGATCCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link