cnnm2a

Ensembl ID:
ENSDARG00000061195
ZFIN ID:
ZDB-GENE-050208-36
Description:
cyclin M2a [Source:RefSeq peptide;Acc:NP_001138257]
Human Orthologue:
CNNM2
Human Description:
cyclin M2 [Source:HGNC Symbol;Acc:103]
Mouse Orthologue:
Cnnm2
Mouse Description:
cyclin M2 Gene [Source:MGI Symbol;Acc:MGI:2151054]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14149 Nonsense Available for shipment Available now
sa22317 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087001 Nonsense 672 811 6 8
Genomic Location:
Chromosome 13 (position 28859743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTCTTTTTTCCGTCCTCTTGCTSTCCAGTTCCTCTCTCCTTGTCT[C/T]GAACCTTCGTGGTCAGCAGGGCAGAATCACTGGCAGRATCTCCAGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087001 Nonsense 751 811 8 8
Genomic Location:
Chromosome 13 (position 28866377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAACGGCTGATTGATTCTAAATCTCCATTTTTCAGGTGACCCGCCAG[C/T]AATACCAGAATGCCCTGATGGCATCTCGCATGGACAAAACACCTCAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vd0cabe1