LOC562999

Ensembl ID:
ENSDARG00000061194
Human Orthologue:
HECTD2
Human Description:
HECT domain containing 2 [Source:HGNC Symbol;Acc:26736]
Mouse Orthologue:
Hectd2
Mouse Description:
HECT domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2442663]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6244 Nonsense Mutation detected in F1 DNA During 2014
sa2673 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086984 Nonsense 444 756 13 21
Genomic Location:
Chromosome 12 (position 17430733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTTGTTGGAGAAGCAGGATTGGACATGGGTGGACTCACGAAAGAGTG[G/A]TTTCTTCTCCTGATTCGACAGATTTTTCACACAGACTACGGTAAGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086984 Nonsense 643 756 19 21
Genomic Location:
Chromosome 12 (position 17405002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTTGTACTTAGCTCTTAAGGCCAGAGGAGGTTGAGATCCTGGTTTGT[G/T]GAAGTCCTAATCTGGACATGGGCTCTCTGMAGCGAGTAGTGCAGTATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/51db1zla