plekho1a

Ensembl ID:
ENSDARG00000061191
ZFIN ID:
ZDB-GENE-060503-433
Description:
Pleckstrin homology domain-containing family O member 1-A [Source:UniProtKB/Swiss-Prot;Acc:A4IG55]
Human Orthologue:
PLEKHO1
Human Description:
pleckstrin homology domain containing, family O member 1 [Source:HGNC Symbol;Acc:24310]
Mouse Orthologue:
Plekho1
Mouse Description:
pleckstrin homology domain containing, family O member 1 Gene [Source:MGI Symbol;Acc:MGI:1914470]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31036 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087002 Nonsense 371 520 6 6
ENSDART00000110075 Nonsense 337 486 5 5
Genomic Location (Zv9):
Chromosome 19 (position 43888958)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42798760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACAGCGCAAACTCACCCTCGGTGCGCGCAAAAGACTCACCCTCTTCC[A/T]AAAGCAAAGAATCGCCTCATGCGAAATCAAAAGACTCCCCCCGTTTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link