cbx5

Ensembl ID:
ENSDARG00000061187
ZFIN ID:
ZDB-GENE-030131-5553
Description:
chromobox protein homolog 5 [Source:RefSeq peptide;Acc:NP_001073653]
Human Orthologue:
CBX5
Human Description:
chromobox homolog 5 [Source:HGNC Symbol;Acc:1555]
Mouse Orthologue:
Cbx5
Mouse Description:
chromobox homolog 5 (Drosophila HP1a) Gene [Source:MGI Symbol;Acc:MGI:109372]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3244 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086985 Nonsense 16 204 3 6
ENSDART00000133259 Nonsense 16 198 3 6
ENSDART00000136929 Nonsense 16 157 3 5
ENSDART00000142760 Nonsense 16 204 2 5
ENSDART00000143340 Nonsense 16 204 4 7
ENSDART00000146986 Nonsense 16 73 3 4
ENSDART00000147598 Nonsense 16 189 3 6
Genomic Location:
Chromosome 23 (position 36354696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCATGGGAAAGAAGAGCCAGAACCGTGAAGATGATGAAGCTGCTTCCT[C/A]AGATGAGGAAGAGTACGTTGTGGAGAAGGTCTTGGACAGGAGAGTTGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7crew98e