LOC100331333

Ensembl ID:
ENSDARG00000061186
Human Orthologue:
ITGA4
Human Description:
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) [Source:HGNC Symbol;Acc:6140]
Mouse Orthologue:
Itga4
Mouse Description:
integrin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:96603]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14884 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 468 739 14 20
Genomic Location:
Chromosome 9 (position 45134544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCGTCCAGTGGTGAAGGTGGATGCTGTYATGTTGTTGCCTGAGAGCT[T/A]GAATCGKTCTGTAGCCCAGTGCACTGAAAAYGGCCAGCCTGCTGTCTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yillboc1