LOC100331333

Ensembl ID:
ENSDARG00000061186
Human Orthologue:
ITGA4
Human Description:
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) [Source:HGNC Symbol;Acc:6140]
Mouse Orthologue:
Itga4
Mouse Description:
integrin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:96603]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34752 Nonsense Mutation detected in F1 DNA During 2016
sa34753 Nonsense Available for shipment Available now
sa14884 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 296 739 9 20
Genomic Location (Zv9):
Chromosome 9 (position 45121204)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44246339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGACACAATAGTCATGTTTGTTCCTGTTTACAGCTTGGCTCTTATTA[T/A]GGGGCGAGTGTTTGTGCTGTCGACCTGAACGCAGATGGACTGTCTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 358 739 10 20
Genomic Location (Zv9):
Chromosome 9 (position 45123239)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44248374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGCTGACTTTGAGTTAGTCGGCAGTGACTCTTATGCCGCACGATTT[G/T]GAGAAACCATCATAAACCTCGGTGATATTGATGATGATGGATATCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086963 Nonsense 468 739 14 20
Genomic Location (Zv9):
Chromosome 9 (position 45134544)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44259679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCGTCCAGTGGTGAAGGTGGATGCTGTYATGTTGTTGCCTGAGAGCT[T/A]GAATCGKTCTGTAGCCCAGTGCACTGAAAAYGGCCAGCCTGCTGTCTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link