mov10b.1

Ensembl ID:
ENSDARG00000061177
ZFIN ID:
ZDB-GENE-030131-9089
Description:
Putative helicase mov-10-B.1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LXK4]
Human Orthologue:
MOV10
Human Description:
Mov10, Moloney leukemia virus 10, homolog (mouse) [Source:HGNC Symbol;Acc:7200]
Mouse Orthologue:
Mov10
Mouse Description:
Moloney leukemia virus 10 Gene [Source:MGI Symbol;Acc:MGI:97054]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41228 Nonsense Mutation detected in F1 DNA During 2016
sa41227 Nonsense Mutation detected in F1 DNA During 2016
sa41226 Nonsense Mutation detected in F1 DNA During 2016
sa13853 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086946 Nonsense 96 1013 3 22
Genomic Location:
Chromosome 8 (position 28534107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATTTATAGATTCGAGTGAGGCAAAATGATCAATGGTCCAGACCCTA[T/A]CGCAGCCAACAAAACCATGCTACACCCCATCTTAATGATGCTATTTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086946 Nonsense 290 1013 5 22
Genomic Location:
Chromosome 8 (position 28533305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCACAGGTCCGAGCTCACGGCACAGCTGGGTCCTACAGAACCATTC[A/T]GACCTAAGAGGCTTGACACCAATCAACCAATGAAGTGGAGCATAGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086946 Nonsense 366 1013 7 22
Genomic Location:
Chromosome 8 (position 28528444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGATTTGTAGGTTAACTCTGGAGAGTGATTTGAGTTTTAATAACTA[T/A]ATGGACCGCTTTGATTTGCTTCTGTACCTGGAGGAGGATCAGATGCGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086946 Nonsense 643 1013 12 22
Genomic Location:
Chromosome 8 (position 28521687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAAGGAGAAAATATTATTTTTCCATGTAAAGAGGAWCTAATGCCCTA[C/A]AAGAKCGTGGTCTGCACTCTGGTMACTGCCGGCAGGTAAAATGCTTTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link