si:ch211-255l12.1

Ensembl ID:
ENSDARG00000061168
ZFIN ID:
ZDB-GENE-061207-30
Description:
probable ATP-dependent RNA helicase DHX34 [Source:RefSeq peptide;Acc:NP_001121805]
Human Orthologue:
DHX34
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 34 [Source:HGNC Symbol;Acc:16719]
Mouse Orthologue:
Dhx34
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 34 Gene [Source:MGI Symbol;Acc:MGI:1918973]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5915 Nonsense Mutation detected in F1 DNA During 2017
sa23373 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086943 Nonsense 266 1150 3 17
Genomic Location (Zv9):
Chromosome 18 (position 42986425)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44576316
KASP Assay ID:
554-3804.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCAAACTGCTGTTCCTCACYGAGGGMCTGCTGCTCMGGCAGATCCAG[C/T]AGGACGCGTCGCTGGGCCAGTACCAGGTGCTGATCGTAGACGAGGTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086943 Essential Splice Site 997 1150 14 17
Genomic Location (Zv9):
Chromosome 18 (position 43001455)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44591346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGAGAAGCTCTGTGAGGGACTTGTGCGGTTTCTGCTGTACACTGAGG[T/C]AGTGACGTAAACACTGTAATGATGAGTGTGTATTACAACTGCATGATTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link