LOC100331939

Ensembl ID:
ENSDARG00000061162
Human Orthologue:
EPHX4
Human Description:
epoxide hydrolase 4 [Source:HGNC Symbol;Acc:23758]
Mouse Orthologue:
Ephx4
Mouse Description:
epoxide hydrolase 4 Gene [Source:MGI Symbol;Acc:MGI:2686228]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33847 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086929 Essential Splice Site 206 370 4 7
Genomic Location (Zv9):
Chromosome 6 (position 20557440)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24245334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACAAAACTCATAGTGCTAAACAGCCCTCACCCCTGTGTATTCACTGG[T/G]AAGTGCCCCATACATCTGACAATCAGACCTGTCCTATCATATCAGCCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link