gltscr1

Ensembl ID:
ENSDARG00000061159
ZFIN ID:
ZDB-GENE-031116-2
Description:
Novel protein similar to human glioma tumor suppressor candidate region gene 1 (GLTSCR1) [Source:Uni
Human Orthologue:
KIAA0240
Human Description:
KIAA0240 [Source:HGNC Symbol;Acc:21111]
Mouse Orthologue:
BC032203
Mouse Description:
cDNA sequence BC032203 Gene [Source:MGI Symbol;Acc:MGI:2673855]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43165 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36722 Nonsense Mutation detected in F1 DNA During 2016
sa29089 Nonsense Mutation detected in F1 DNA During 2016
sa16525 Nonsense Available for shipment Available now
sa23374 Nonsense Available for shipment Available now
sa13301 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098540 Essential Splice Site 30 1800 3 13
ENSDART00000144271   1 1771 1 11
Genomic Location (Zv9):
Chromosome 18 (position 43048443)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44638334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAAATGTGACTGGGTCTAGTTTTTAAAAAGTCTGTCTGTGTTTTCCA[G/T]GGCCATGTTCCTGAGGTTCCGGCACAGGTTCAGCTGTCGACAAGTGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098540 Nonsense 217 1800 3 13
ENSDART00000144271 Nonsense 188 1771 1 11
Genomic Location (Zv9):
Chromosome 18 (position 43049005)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44638896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTCAGGCCCTACCGAACGGCAGCCAGTCTGGACCGTTGGGCATTGGA[C/T]AAATTCAAGTGGTGGGTCAGCCCACTGTAATGACTATAAATCCATCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098540 Nonsense 427 1800 3 13
ENSDART00000144271 Nonsense 398 1771 1 11
Genomic Location (Zv9):
Chromosome 18 (position 43049635)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44639526
KASP Assay ID:
2261-2568.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACACAGGCAGCGTCGCAGGGAACACAGTTTTCTCAAGCGCTCTTTAAA[C/T]AGCAGGGCCCTCAAACTTCAGGCAAACCCCTCAGTGTTCACTTGTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098540 Nonsense 698 1800 3 13
ENSDART00000144271 Nonsense 669 1771 1 11
Genomic Location (Zv9):
Chromosome 18 (position 43050448)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44640339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTTCACGTCACCTGGTTCCGGCATGATCCTGAGCCAGGAGCCTCTT[C/T]AAATGTTCCTGCACCAGGTCAGTGTGCTCTCTTTAAACTTTATCTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098540 Nonsense 917 1800 5 13
ENSDART00000144271 Nonsense 888 1771 3 11
Genomic Location (Zv9):
Chromosome 18 (position 43054654)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44644545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCAGCCACTTCCCACACAGTTCCAGTTCCAGCCCCCAGTCTCCAGCT[C/A]GTCTCCAGCTGCAGCAGTGAAACAGCAGGTGACGGTGGTGCCTGGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098540 Nonsense 1694 1800 13 13
ENSDART00000144271 Nonsense 1665 1771 11 11
Genomic Location (Zv9):
Chromosome 18 (position 43062262)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44652153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTCTTCCTGCACAAGAGACTCGTCACTTCCTGCCAAACGCTGCAAGT[C/A]GGACTCTCCRGACATGGACAATGCAAGCTTCTCCAGCGGCAGCCCGCYGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link