erbb4b

Ensembl ID:
ENSDARG00000061142
ZFIN ID:
ZDB-GENE-030918-5
Description:
Novel protein similar to vertebrate v-erb-a erythroblastic leukemia viral oncogene homolog 4 (Avian)
Human Orthologue:
ERBB4
Human Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Mouse Orthologue:
Erbb4
Mouse Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) Gene [Source:MGI Symbol;Acc:MGI:104

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21550 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100398 Essential Splice Site 312 563 8 14
ENSDART00000147135 Essential Splice Site 545 740 13 18
Genomic Location:
Chromosome 9 (position 40523521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGGCCAACAATGAGTGTCACCCCTGCCATGTCAACTGCACCCAGGGG[T/C]ATGGATAGCTTTGTTAAATGTTTGCAATGTGTGTGTGTGTGTTGGGGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pjnjhik1