KIF21A (2 of 2)

Ensembl ID:
ENSDARG00000061131
Description:
kinesin family member 21A [Source:HGNC Symbol;Acc:19349]
Human Orthologue:
KIF21A
Human Description:
kinesin family member 21A [Source:HGNC Symbol;Acc:19349]
Mouse Orthologue:
Kif21a
Mouse Description:
kinesin family member 21A Gene [Source:MGI Symbol;Acc:MGI:109188]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24729 Nonsense Mutation detected in F1 DNA During 2016
sa30310 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39494 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1024 Nonsense Available for shipment Available now
sa44352 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14802 Essential Splice Site Available for shipment Available now
sa44353 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44354 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Nonsense 66 1647 1 39
Genomic Location (Zv9):
Chromosome 25 (position 36796530)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35204146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTACTCCAACTGCACCGAGAAGCTGATCGAGGGCTGTTTTGAGGGATA[C/A]AACGCCACCATATTTGCATACGGACAGGTTTGTGTGGGATTTGTACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Essential Splice Site 326 1647 6 39
Genomic Location (Zv9):
Chromosome 25 (position 36804669)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35212285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTCCAAACTCACCCGCCTCCTGCAGGACTCACTGGGCGGAAACAGG[T/A]CTGTGTCTCAATACCTGCTGGATTCTCTCATTGCTTTCATTACCGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Essential Splice Site 556 1647 12 39
Genomic Location (Zv9):
Chromosome 25 (position 36815251)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35222867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTAAAACAGAGATTTTTGAACACTACACACAATAGATTTTTGATTT[A/T]GCATTATTCTCTTGCAGTGCCAACAAAGACGAAACGCAAGAAGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Nonsense 802 1647 17 39
Genomic Location (Zv9):
Chromosome 25 (position 36818316)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35225932
KASP Assay ID:
554-0928.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTWTGTTTTCCGTGTGTGCAGCATCAGCTCAAACTGCTGGAGGCA[C/T]AGAAGAGACAACAGGAGCTCATCCTGCGCAGGAAAACCGAGGAGGTCTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa44352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Essential Splice Site 1031 1647 22 39
Genomic Location (Zv9):
Chromosome 25 (position 36826100)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35233716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAAGCTCGATTCCTTCTGGACCATTTCATGTCGATGGCCCTCAATAAG[G/A]TCTCCAGCTGACAGTCTCATTATTAATAACGAGCTATGATGTTACCGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Essential Splice Site 1087 1647 23 39
Genomic Location (Zv9):
Chromosome 25 (position 36826364)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35233980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGTTTAACCCGGAGCTGGATGCGTTATTGGGGAACGCTCTTCAAGG[T/C]AGGAATACTCCTYCTAGGACGCATGCATTAGAYCTTTGATTTGCTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Essential Splice Site 1282 1647 32 39
Genomic Location (Zv9):
Chromosome 25 (position 36835021)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35242637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATCTGAACCACATTCATTGGCTTGCGTGCCTGAGATTGTTTGTTTTA[T/A]GAAGTATTTTGGGTGAACTACAGTGCCATAAAAAAGTATTTGCTTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Nonsense 1345 1647 34 39
Genomic Location (Zv9):
Chromosome 25 (position 36842870)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35250486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTAACTATATTAACCTGGGTTTTTCCTTTTTTCAGATCGTACCTG[T/A]AAAGTTTGGAATTTAGTGACGGGACAGGAGATCATGTCTCTGGGCGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link