KIF21A (2 of 2)

Ensembl ID:
ENSDARG00000061131
Description:
kinesin family member 21A [Source:HGNC Symbol;Acc:19349]
Human Orthologue:
KIF21A
Human Description:
kinesin family member 21A [Source:HGNC Symbol;Acc:19349]
Mouse Orthologue:
Kif21a
Mouse Description:
kinesin family member 21A Gene [Source:MGI Symbol;Acc:MGI:109188]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24729 Nonsense Mutation detected in F1 DNA During 2014
sa1024 Nonsense Available for shipment Available now
sa14802 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Nonsense 66 1647 1 39
Genomic Location:
Chromosome 25 (position 36796530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTACTCCAACTGCACCGAGAAGCTGATCGAGGGCTGTTTTGAGGGATA[C/A]AACGCCACCATATTTGCATACGGACAGGTTTGTGTGGGATTTGTACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Nonsense 802 1647 17 39
Genomic Location:
Chromosome 25 (position 36818316)
KASP Assay ID:
554-0928.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTWTGTTTTCCGTGTGTGCAGCATCAGCTCAAACTGCTGGAGGCA[C/T]AGAAGAGACAACAGGAGCTCATCCTGCGCAGGAAAACCGAGGAGGTCTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004087 Essential Splice Site 1087 1647 23 39
Genomic Location:
Chromosome 25 (position 36826364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGTTTAACCCGGAGCTGGATGCGTTATTGGGGAACGCTCTTCAAGG[T/C]AGGAATACTCCTYCTAGGACGCATGCATTAGAYCTTTGATTTGCTCCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e4fbed7d