si:ch211-209p5.2

Ensembl ID:
ENSDARG00000061121
ZFIN ID:
ZDB-GENE-030131-7856
Description:
Novel protein similar to vertebrate latrophilin 3 (LPHN3) [Source:UniProtKB/TrEMBL;Acc:A8E7J9]
Human Orthologue:
LPHN3
Human Description:
latrophilin 3 [Source:HGNC Symbol;Acc:20974]
Mouse Orthologue:
Lphn3
Mouse Description:
latrophilin 3 Gene [Source:MGI Symbol;Acc:MGI:2441950]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24843 Nonsense Mutation detected in F1 DNA During 2017
sa11206 Nonsense Available for shipment Available now
sa11727 Nonsense Available for shipment Available now
sa19494 Nonsense Available for shipment Available now
sa19493 Essential Splice Site Available for shipment Available now
sa19492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366 Nonsense 3 162 1 3
ENSDART00000086797   None 1346 None 19
ENSDART00000144208 Nonsense 3 1516 2 21
ENSDART00000146871   None 1098 None 16
Genomic Location (Zv9):
Chromosome 1 (position 21884896)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22420063
KASP Assay ID:
554-7821.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCCTTTCTTTTTTAGGTGTGCGCGTCAGAAAGAAGCGCAATGGCTT[T/A]AACGTGTCCGAGACGCAGCTTCAGCGAGTCAGTGCAGAGGTCAACAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366   None 162 None 3
ENSDART00000086797 Nonsense 3 1346 1 19
ENSDART00000144208 Nonsense 192 1516 5 21
ENSDART00000146871   None 1098 None 16
Genomic Location (Zv9):
Chromosome 1 (position 21846727)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22381894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGGTGTAAGGACCCCTTACAGTCATCCAATAAGATCTACTACATGCCCT[G/A]GACACCGTATCGCACAGACACACTGACTGAGTATTCAWCTAAGGAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366   None 162 None 3
ENSDART00000086797 Nonsense 321 1346 2 19
ENSDART00000144208 Nonsense 510 1516 6 21
ENSDART00000146871 Nonsense 92 1098 1 16
Genomic Location (Zv9):
Chromosome 1 (position 21814180)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22349347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTGCTGAAATCTCCTGGCCACGGACACACCAGGGAMAAGYTGCTAAG[C/T]AACCGTGCCCACCTGGCACCATAGGTTAGTAAGAGAGTGATTAATCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366   None 162 None 3
ENSDART00000086797 Nonsense 462 1346 6 19
ENSDART00000144208 Nonsense 638 1516 9 21
ENSDART00000146871 Nonsense 220 1098 4 16
Genomic Location (Zv9):
Chromosome 1 (position 21794309)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22329476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCAGGTGCGATCTCAGGCGGCGTGGAGAGAGCTTTCTGTAGCCGAG[C/T]AGCTGCGATGCGCAACCATGCTCCTGGACACGGTGGAGACGGGAGCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366   None 162 None 3
ENSDART00000086797 Essential Splice Site 737 1346 11 19
ENSDART00000144208 Essential Splice Site 913 1516 14 21
ENSDART00000146871 Essential Splice Site 495 1098 9 16
Genomic Location (Zv9):
Chromosome 1 (position 21762256)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22297423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTAGATAGTTTGAGCAGCGTTTGTGCTCTGTGTGTATGTCTTTGTTAC[A/T]GATCGTCTGCGCTGTGTTTGCGGCCCTGCTGCATTTCTTCTTCTTGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042366   None 162 None 3
ENSDART00000086797 Nonsense 805 1346 11 19
ENSDART00000144208 Nonsense 981 1516 14 21
ENSDART00000146871 Nonsense 563 1098 9 16
Genomic Location (Zv9):
Chromosome 1 (position 21762048)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22297215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCAGCTGTCATAGTAGCTGTATCGGCTGCTGTGGACTACCGTAGCTA[C/A]GGCACTGAAAGAGTGTAAGTAAATGACAGATCTATTTCCCATGGTAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link