ep300b

Ensembl ID:
ENSDARG00000061108
ZFIN ID:
ZDB-GENE-080403-15
Description:
P300-B [Source:UniProtKB/TrEMBL;Acc:Q1L664]
Human Orthologue:
EP300
Human Description:
E1A binding protein p300 [Source:HGNC Symbol;Acc:3373]
Mouse Orthologue:
Ep300
Mouse Description:
E1A binding protein p300 Gene [Source:MGI Symbol;Acc:MGI:1276116]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6889 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31328 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38388 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33173 Nonsense Mutation detected in F1 DNA During 2016
sa33172 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6888 Nonsense Mutation detected in F1 DNA During 2016
sa20005 Nonsense Available for shipment Available now
sa26061 Nonsense Mutation detected in F1 DNA During 2016
sa33171 Nonsense Mutation detected in F1 DNA During 2016
sa31327 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Essential Splice Site 281 2573 4 31
Genomic Location:
Chromosome 3 (position 25142193)
KASP Assay ID:
554-5038.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTRGAACTGCAGGAGCATGAAAACACTCTTYGGTCTGTCTKTCTCCA[G/T]CAGGGCCCAGGTGTGGTGGGTGGTGTATCGGGRCCAGGTGGGACGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Essential Splice Site 679 2573 12 31
Genomic Location:
Chromosome 3 (position 25131679)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACAGAGGGCCACGCCTCCCCTGCCAATGGGTGCAAACCTCAATCAGG[T/A]AATTTCACTTGCCACCCAAAGGTCGGCGACTGATGTAAATGTACCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Essential Splice Site 1144 2573 18 31
Genomic Location:
Chromosome 3 (position 25118842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAATAGACCCTGTTATGCAGGAGTTGGGCTACTGCTGTGGAAGGAAGG[T/C]CAGTGTGTCGCTTGAGGGCTTTATTTATTTATTTATTTATTTATTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 1377 2573 25 31
Genomic Location:
Chromosome 3 (position 25103758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTGGAATGCATGTTCAAGAATACGGCTCTGATTGCCCTCCACCTAAT[C/T]AAAGGTTAAAAATAACAAAGACTCAGTCACACATCTTCAGGCACACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Essential Splice Site 1471 2573 26 31
Genomic Location:
Chromosome 3 (position 25103327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGATGCTTGACAAAGCAGTAACTGAGAGAATTGTACATGACTACAAG[G/A]TACAGCGACAGCTGACTATAATGAAAGTTTACACTAACGTCAGCATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 2092 2573 30 31
Genomic Location:
Chromosome 3 (position 25100993)
KASP Assay ID:
554-5022.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCAACAGGTCGCTGTGCAAGGTCAGATGCCCCCACAAATGCATCCA[C/T]AGCAGCCGAGAATGAATCCACCACTTCAGCCTCAACAGCAACAGTGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 2260 2573 30 31
Genomic Location:
Chromosome 3 (position 25100489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGTGGGTGTCAATACTGGGGTTCCCCAACCTGGTATGCATCTTGGA[C/T]AAGGTGTTAACATGCAGAGTCAACTTCTGAGTCAACAACAGAGCCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 2303 2573 31 31
Genomic Location:
Chromosome 3 (position 25100162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAACAGCAATTACAGTTTCAGCAGCAACAGCAGCAACAACAGCAACAA[C/T]AACAACAACAAATGAGCAATCATGCGGCATTCCAGCAGCAGCAAGGTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 2439 2573 31 31
Genomic Location:
Chromosome 3 (position 25099754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTGGCACCTCTCCGGCACAGCAAAACAACCCAATGAGTCCACAGCAG[C/T]AACAGATATCTCAGTCGCCCCACTTGCAGGGCCAGCAGCTCCCATCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 2483 2573 31 31
Genomic Location:
Chromosome 3 (position 25099622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCACGACCCCAGTCCCAGCCACCTCACTCAAGTCCGTCCCCACGCCTG[C/T]AACCTCAGCCCTCACCTCACCACATCTCGCCTCAAACCCAAACAGGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link