ep300b

Ensembl ID:
ENSDARG00000061108
ZFIN ID:
ZDB-GENE-080403-15
Description:
P300-B [Source:UniProtKB/TrEMBL;Acc:Q1L664]
Human Orthologue:
EP300
Human Description:
E1A binding protein p300 [Source:HGNC Symbol;Acc:3373]
Mouse Orthologue:
Ep300
Mouse Description:
E1A binding protein p300 Gene [Source:MGI Symbol;Acc:MGI:1276116]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6889 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6888 Nonsense Mutation detected in F1 DNA During 2014
sa20005 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Essential Splice Site 281 2573 4 31
Genomic Location:
Chromosome 3 (position 25142193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTRGAACTGCAGGAGCATGAAAACACTCTTYGGTCTGTCTKTCTCCA[G/T]CAGGGCCCAGGTGTGGTGGGTGGTGTATCGGGRCCAGGTGGGACGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 2092 2573 30 31
Genomic Location:
Chromosome 3 (position 25100993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCAACAGGTCGCTGTGCAAGGTCAGATGCCCCCACAAATGCATCCA[C/T]AGCAGCCGAGAATGAATCCACCACTTCAGCCTCAACAGCAACAGTGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086768 Nonsense 2260 2573 30 31
Genomic Location:
Chromosome 3 (position 25100489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGTGGGTGTCAATACTGGGGTTCCCCAACCTGGTATGCATCTTGGA[C/T]AAGGTGTTAACATGCAGAGTCAACTTCTGAGTCAACAACAGAGCCAACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dy360m1a