nfasca

Ensembl ID:
ENSDARG00000061099
ZFIN IDs:
ZDB-GENE-080229-6, ZDB-GENE-080229-6
Description:
neurofascin [Source:RefSeq peptide;Acc:NP_001139239]
Human Orthologue:
NFASC
Human Description:
neurofascin [Source:HGNC Symbol;Acc:29866]
Mouse Orthologue:
Nfasc
Mouse Description:
neurofascin Gene [Source:MGI Symbol;Acc:MGI:104753]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21901 Nonsense Available for shipment Available now
sa21902 Nonsense Available for shipment Available now
sa13971 Nonsense Available for shipment Available now
sa38839 Nonsense Mutation detected in F1 DNA During 2017
sa31826 Nonsense Available for shipment Available now
sa27780 Nonsense Mutation detected in F1 DNA During 2017
sa27781 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086720 Nonsense 96 739 6 20
ENSDART00000112655 Nonsense 96 743 4 20
ENSDART00000121874 Nonsense 96 1340 4 32
ENSDART00000127846 Nonsense 96 1369 4 30
Genomic Location (Zv9):
Chromosome 11 (position 24748383)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23587682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAAGTTCTTTAATGTGGGTAAGGACCCACGGGTGACCATGAGAAGT[C/T]GATCTGGAACACTAGAGATCAGAAGCAGTGGAAAACCAGAAGATTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086720 Nonsense 415 739 12 20
ENSDART00000112655 Nonsense 415 743 10 20
ENSDART00000121874 Nonsense 418 1340 11 32
ENSDART00000127846 Nonsense 415 1369 10 30
Genomic Location (Zv9):
Chromosome 11 (position 24757988)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23597287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAAAGCAGTGCAGTTTACCAGTGTAACGCCTCCAATGAGCACGGTTA[T/A]CTTCTGGCAAATGCTTTCGTCAGTGTTTTGGGTATGACAGGATGAAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086720   None 739 None 20
ENSDART00000112655   None 743 None 20
ENSDART00000121874 Nonsense 800 1340 20 32
ENSDART00000127846 Nonsense 797 1369 19 30
Genomic Location (Zv9):
Chromosome 11 (position 24765115)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23604414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCCAAAACAAAAMACGTTGTCCATAATACAGACACCTACGTTCCTTA[T/A]GAGATCAAAATACAGRCTGTYAATGACTTTGGACATGGCCCAGAGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086720   None 739 None 20
ENSDART00000112655   None 743 None 20
ENSDART00000121874 Nonsense 803 1340 20 32
ENSDART00000127846 Nonsense 800 1369 19 30
Genomic Location (Zv9):
Chromosome 11 (position 24765122)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23604421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAAAACACGTTGTCCATAATACAGACACCTACGTTCCTTATGAGATC[A/T]AAATACAGGCTGTCAATGACTTTGGACATGGCCCAGAGTCAAACATGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086720   None 739 None 20
ENSDART00000112655   None 743 None 20
ENSDART00000121874 Nonsense 822 1340 20 32
ENSDART00000127846 Nonsense 819 1369 19 30
Genomic Location (Zv9):
Chromosome 11 (position 24765181)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23604480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTCAATGACTTTGGACATGGCCCAGAGTCAAACATGGTCATCGGTTA[T/A]TCTGGGGAAGACAGTAAGTACTATCATGTCATCTTTAATGACACTTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086720   None 739 None 20
ENSDART00000112655   None 743 None 20
ENSDART00000121874 Nonsense 1175 1340 29 32
ENSDART00000127846 Nonsense 1204 1369 27 30
Genomic Location (Zv9):
Chromosome 11 (position 24786236)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23625535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGCAGCCTCACATTAAGCTGGCTGGGCTGGTGGCTGGGGCCAAGTA[T/A]CGGTTGCGGGTCTATTCGCATGAGCACAACTCCATCAGCAGCGACTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086720   None 739 None 20
ENSDART00000112655   None 743 None 20
ENSDART00000121874 Essential Splice Site 1242 1340 30 32
ENSDART00000127846 Essential Splice Site 1271 1369 28 30
Genomic Location (Zv9):
Chromosome 11 (position 24791101)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23630400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCATTGTTTGTTTCATCAAGAGGAGTCGTGGAGGAAAATACCCAGG[T/G]AAACAAACAGCATAGTTCATTACTATATTAAAGGTACAATTATTAGTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link