KIF21A (1 of 2)

Ensembl ID:
ENSDARG00000061089
Description:
kinesin family member 21A [Source:HGNC Symbol;Acc:19349]
Human Orthologue:
KIF21A
Human Description:
kinesin family member 21A [Source:HGNC Symbol;Acc:19349]
Mouse Orthologue:
Kif21a
Mouse Description:
kinesin family member 21A Gene [Source:MGI Symbol;Acc:MGI:109188]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25287 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086743 Essential Splice Site 271 352 5 7
Genomic Location (Zv9):
Chromosome 4 (position 60190365)
KASP Assay ID:
554-7450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACACAGCTACTCACCGACCAGGCAAACCAGACCCTCGCCAGAGCAGG[T/C]ACACACACACACACACACACACACACACACAATCACATTTACACATATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link