LOC572002

Ensembl ID:
ENSDARG00000061082
Human Orthologue:
ERC2
Human Description:
ELKS/RAB6-interacting/CAST family member 2 [Source:HGNC Symbol;Acc:31922]
Mouse Orthologue:
Erc2
Mouse Description:
ELKS/RAB6-interacting/CAST family member 2 Gene [Source:MGI Symbol;Acc:MGI:1098749]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4432 Nonsense Mutation detected in F1 DNA During 2014
sa13294 Nonsense Available for shipment Available now
sa4431 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa4432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086713 Nonsense 221 619 2 7
Genomic Location:
Chromosome 11 (position 38294309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGATCCCATCATGTTGACCCCTGCTCTGTTTCCAYCTCCAGCACCTC[C/T]AGCTGACCATCCAGGCTCTGCAGGACGAGCTGAGGACCCAGCGAGACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086713 Nonsense 275 619 2 7
Genomic Location:
Chromosome 11 (position 38294147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGCTGACCGAAGAAAACTTCCGCAGGCTTCAGGCTGAACACGACCGA[C/T]AGGCCAAAGAGCTGTTCCTTCTAAGAAAAACCCTGGAGGAGAWGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4431
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086713 Nonsense 337 619 2 7
Genomic Location:
Chromosome 11 (position 38293961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGCTTCAGGACGGGCATCAGATGAGGAGGAGCAAGAGCGAGCCCGA[C/T]GAATCGCTGAAGCTGAAGCTCAGCTCGGACACCTGGAGGTCATCCWGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ub5jj4b8