LOC572002

Ensembl ID:
ENSDARG00000061082
Human Orthologue:
ERC2
Human Description:
ELKS/RAB6-interacting/CAST family member 2 [Source:HGNC Symbol;Acc:31922]
Mouse Orthologue:
Erc2
Mouse Description:
ELKS/RAB6-interacting/CAST family member 2 Gene [Source:MGI Symbol;Acc:MGI:1098749]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13294 Nonsense Available for shipment Available now
sa4431 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa13294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086713 Nonsense 275 619 2 7
Genomic Location (Zv9):
Chromosome 11 (position 38294147)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37106145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGCTGACCGAAGAAAACTTCCGCAGGCTTCAGGCTGAACACGACCGA[C/T]AGGCCAAAGAGCTGTTCCTTCTAAGAAAAACCCTGGAGGAGAWGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4431
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086713 Nonsense 337 619 2 7
Genomic Location (Zv9):
Chromosome 11 (position 38293961)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37105959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGCTTCAGGACGGGCATCAGATGAGGAGGAGCAAGAGCGAGCCCGA[C/T]GAATCGCTGAAGCTGAAGCTCAGCTCGGACACCTGGAGGTCATCCWGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link