c2cd2l

Ensembl ID:
ENSDARG00000061066
ZFIN ID:
ZDB-GENE-041019-1
Description:
C2 domain-containing protein 2-like [Source:RefSeq peptide;Acc:NP_001070851]
Human Orthologue:
C2CD2L
Human Description:
C2CD2-like [Source:HGNC Symbol;Acc:29000]
Mouse Orthologue:
C2cd2l
Mouse Description:
C2 calcium-dependent domain containing 2-like Gene [Source:MGI Symbol;Acc:MGI:1919014]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8191 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086686 Nonsense 290 708 7 15
ENSDART00000142958 Nonsense 294 712 8 16
Genomic Location:
Chromosome 5 (position 32193153)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGCAGATTGGTGGTCTWAACTCTCCATCTCAGAGCACACCAGGCAGG[C/T]GAATACTGGTGCACCAACTCAGAGCAAGCAATGTCAAAAAAGGTATGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4kez9z64