dpagt1

Ensembl ID:
ENSDARG00000061061
ZFIN ID:
ZDB-GENE-060526-18
Description:
UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase [Source:RefSeq pe
Human Orthologue:
DPAGT1
Human Description:
dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P tra
Mouse Orthologue:
Dpagt1
Mouse Description:
dolichyl-phosphate (UDP-N-acetylglucosamine) acetylglucosaminephosphotransferase 1 (GlcNAc-1-P trans

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10435 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086661 Splice Site, Nonsense 305 406 7 9
Genomic Location (Zv9):
Chromosome 5 (position 32233010)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29993840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGAAATTATTGTGTGGGCTTGACATCTAAATCTGATTAATACAGGT[T/A]ACAGTCAGACACAGGAAAGCTGGGYATGAGCTACTCCAAATTCAAACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link