C4orf37

Ensembl ID:
ENSDARG00000061060
Description:
chromosome 4 open reading frame 37 [Source:HGNC Symbol;Acc:28712]
Human Orthologue:
C4orf37
Human Description:
chromosome 4 open reading frame 37 [Source:HGNC Symbol;Acc:28712]
Mouse Orthologue:
B930007M17Rik
Mouse Description:
RIKEN cDNA B930007M17 gene Gene [Source:MGI Symbol;Acc:MGI:2685863]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20339 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086666 Nonsense 307 526 8 23
Genomic Location (Zv9):
Chromosome 5 (position 7245661)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 6433170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATAGTAACTGTTGATCTTGCTTGTGCATGATAGGTCCGGGTGCCTA[T/A]AACATGTTTGGGTATGGCCTGGCTCAGGAGAGTTTAAAGAAAGCCAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link