nipblb

Ensembl ID:
ENSDARG00000061052
ZFIN ID:
ZDB-GENE-030131-6070
Description:
nipped-B-like protein [Source:RefSeq peptide;Acc:NP_001154919]
Human Orthologue:
NIPBL
Human Description:
Nipped-B homolog (Drosophila) [Source:HGNC Symbol;Acc:28862]
Mouse Orthologue:
Nipbl
Mouse Description:
Nipped-B homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913976]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8848 Nonsense Mutation detected in F1 DNA During 2017
sa18992 Nonsense Mutation detected in F1 DNA During 2017
sa38809 Nonsense Mutation detected in F1 DNA During 2017
sa41710 Nonsense Mutation detected in F1 DNA During 2017
sa41709 Nonsense Mutation detected in F1 DNA During 2017
sa7339 Missense Mutation detected in F1 DNA During 2017
sa17819 Nonsense Available for shipment Available now
sa34952 Essential Splice Site, Missense Available for shipment Available now
sa38808 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10463 Nonsense Available for shipment Available now
sa30653 Nonsense Mutation detected in F1 DNA During 2017
sa31792 Essential Splice Site Available for shipment Available now
sa41708 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 424 2856 9 48
ENSDART00000086861 Nonsense 414 2882 9 47
ENSDART00000108484 Nonsense 414 2876 8 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37766445)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36578606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACCAGCAGGTTCCTGTACTACAAAACATTGGGGCACTTGCAGCTAAA[C/T]AACCCGGGGTAGTTAGTGGAACCCCGTACGATGAGGCAGAGCTGGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 585 2856 10 48
ENSDART00000086861 Nonsense 575 2882 10 47
ENSDART00000108484 Nonsense 575 2876 9 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37765646)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36577807
KASP Assay ID:
2260-3525.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGGGGAGGTGCAGAGGACAGTAGATGGTCGGCCAGAAGTTATCAAG[C/T]AACGAGTGGAAACAACACCACAGAAAACTGCTGTAGATGGACGACCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 629 2856 10 48
ENSDART00000086861 Nonsense 619 2882 10 47
ENSDART00000108484 Nonsense 619 2876 9 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37765514)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36577675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCTCTAACAAAGTGAGTTCGGAAAAGAGGTCAGATTTGTCAAAGCAC[A/T]GACATGATGGTAAAGCTGAGAAAATAAGGGCTGAGGGAAAAGGCCACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653   None 2856 None 48
ENSDART00000086861 Nonsense 818 2882 10 47
ENSDART00000108484 Nonsense 818 2876 9 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37764917)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36577078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGGGAGAAAGATCGGGACAAGGAGATGGAAAAAGCTCGGGAGAAAGAT[C/T]AGGACAAGGAGCTGGAAAAAGGTCGGGAGAAAGATCAGGACAAGGAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 911 2856 11 48
ENSDART00000086861 Nonsense 961 2882 10 47
ENSDART00000108484 Nonsense 961 2876 9 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37764488)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36576649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGAGGATAAACAGGCTCCAGAGCAGCGGTCACGTCCCAACAGTCCT[C/T]GAGTAAAACAGGAACCCCGTAATGGAGAAGAATCCAAAATAAAACCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Missense 1238 2856 16 48
ENSDART00000086861 Missense 1264 2882 15 47
ENSDART00000108484 Missense 1264 2876 14 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37762922)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36575083
KASP Assay ID:
554-4168.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATGCCTCTGCAAGTTTGACGGTAATCGACTTTTTTGCAACTGCAGAT[G/T]ATGATGAGATTCCCCAGGAGCTGCTGCTCGGAAAACACCAGCTCTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 1484 2856 21 48
ENSDART00000086861 Nonsense 1510 2882 20 47
ENSDART00000108484 Nonsense 1510 2876 19 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37757187)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36569348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAGATCTTCACCTCTCTAGCCAGACTGCCAACCAGCAAGAGGAACT[T/A]GAGGAATTACAGGTACTNGCCCAGTCTAGAGATAGTCTTGCAMATGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Missense 1654 2856 25 48
ENSDART00000086861 Missense 1680 2882 24 47
ENSDART00000108484 Essential Splice Site 1677 2876 23 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37750105)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36562266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCACCAGCAAAATGGACCAGCGCTCCATCAACCGCATCCTCGGAGAG[G/A]TAAACAACAGAGTCTGTGTCATCACATGTGGGGCCAAATCAAATTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Essential Splice Site 1758 2856 None 48
ENSDART00000086861 Essential Splice Site 1784 2882 None 47
ENSDART00000108484 Essential Splice Site 1778 2876 None 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37746414)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36558575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTACATTTAGAAGTGTTTTATCATCTCCTGTGCTTTTTTTTTTCATC[A/T]GAGTAAACTCGGATACTGTGGACTATGAGGACTCGTGTCTCATTGTGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 2381 2856 43 48
ENSDART00000086861 Nonsense 2407 2882 42 47
ENSDART00000108484 Nonsense 2401 2876 41 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37731716)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36543877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTGTCGTCCAATTAGATGAAGGCWGTGGCGGGGATGAAGATGTCATA[T/A]CAGGTGCAGCAGGCCATYGTGGGCTCGAAGGACACTGTGATCAGGGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 2518 2856 45 48
ENSDART00000086861 Nonsense 2544 2882 44 47
ENSDART00000108484 Nonsense 2538 2876 43 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37726810)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36538971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGAAGAAGAAGAAGAAGAAGCAGAAGCAGAAGCGAGGGAAGAAGTA[C/A]GGCTCTGAGGAAGAGGATGAGAGCAGTAGGAGTAGCAGCAGCAGTAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Essential Splice Site 2618 2856 46 48
ENSDART00000086861 Essential Splice Site 2644 2882 45 47
ENSDART00000108484 Essential Splice Site 2638 2876 44 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37726121)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36538282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACTTTATGAATGGTTTCATTACAAACGCCTCTTTGTCTGTCCCTGCA[G/A]TAAAATTCAGAAGTACTCGCCTACAGAATCTGCAAAGATTTATGACAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086653 Nonsense 2802 2856 48 48
ENSDART00000086861 Nonsense 2828 2882 47 47
ENSDART00000108484 Nonsense 2822 2876 46 46

The following transcripts of ENSDARG00000061052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37720815)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36532976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGATACAGCATTCACTGGATGGCCGGATCCTACTCCGGCACCTGGGCC[G/T]AGGCCAAGAAACGAGATGGACGCAAACTGGTGCCTTGGGTGGACACTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link