LOC100001603

Ensembl ID:
ENSDARG00000061051
Human Orthologue:
FAM5C
Human Description:
family with sequence similarity 5, member C [Source:HGNC Symbol;Acc:22393]
Mouse Orthologue:
Fam5c
Mouse Description:
family with sequence similarity 5, member C Gene [Source:MGI Symbol;Acc:MGI:2443035]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40731 Nonsense Mutation detected in F1 DNA During 2016
sa20744 Nonsense Mutation detected in F1 DNA During 2016
sa40730 Nonsense Mutation detected in F1 DNA During 2016
sa17402 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086627 Nonsense 237 766 4 7
Genomic Location:
Chromosome 6 (position 35925321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTCTGTCAGTTCTGTGCTGGTTCAGAGCCCTGAGAACAAAGTCCATT[T/A]GCAAGGTATGAAATGATGTTCAAATCTACTATGTCAGGTTGTGATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086627 Nonsense 314 766 5 7
Genomic Location:
Chromosome 6 (position 35920149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATGGAGGAAAGCCTTTTGCGAATCTCTGAATCCTGGGCTCTTACCTA[C/A]AAAGAGTTTGAAGATTCAGGTAGGAGACTGAATTCAGTCATGTTTCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086627 Nonsense 320 766 5 7
Genomic Location:
Chromosome 6 (position 35920132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCGAATCTCTGAATCCTGGGCTCTTACCTACAAAGAGTTTGAAGATT[C/A]AGGTAGGAGACTGAATTCAGTCATGTTTCACACTTTTTTTCAGGTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086627 Nonsense 556 766 7 7
Genomic Location:
Chromosome 6 (position 35910238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATAAATACAAATCCAACCTAGTCCATATGCTTTTAGGCATCTCTCTT[C/T]AAATCTGCCTTACAAAAAACAGCACTCTGGAACCCGCTCTCACCCTSTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link