LOC100001603

Ensembl ID:
ENSDARG00000061051
Human Orthologue:
FAM5C
Human Description:
family with sequence similarity 5, member C [Source:HGNC Symbol;Acc:22393]
Mouse Orthologue:
Fam5c
Mouse Description:
family with sequence similarity 5, member C Gene [Source:MGI Symbol;Acc:MGI:2443035]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20744 Nonsense Mutation detected in F1 DNA During 2014
sa17402 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086627 Nonsense 314 766 5 7
Genomic Location:
Chromosome 6 (position 35920149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATGGAGGAAAGCCTTTTGCGAATCTCTGAATCCTGGGCTCTTACCTA[C/A]AAAGAGTTTGAAGATTCAGGTAGGAGACTGAATTCAGTCATGTTTCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086627 Nonsense 556 766 7 7
Genomic Location:
Chromosome 6 (position 35910238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATAAATACAAATCCAACCTAGTCCATATGCTTTTAGGCATCTCTCTT[C/T]AAATCTGCCTTACAAAAAACAGCACTCTGGAACCCGCTCTCACCCTSTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/en90fggl