ranbp9

Ensembl ID:
ENSDARG00000061048
ZFIN ID:
ZDB-GENE-021030-5
Description:
Ran-binding protein 9 [Source:UniProtKB/Swiss-Prot;Acc:A1L252]
Human Orthologue:
RANBP9
Human Description:
RAN binding protein 9 [Source:HGNC Symbol;Acc:13727]
Mouse Orthologue:
Ranbp9
Mouse Description:
RAN binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:1928741]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19794 Nonsense Available for shipment Available now
sa39858 Nonsense Mutation detected in F1 DNA During 2017
sa25839 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086608 Nonsense 151 597 4 14
Genomic Location (Zv9):
Chromosome 2 (position 31531042)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31829949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCTACCATGGGGACGATGGCCACTCTTTCTGCTCTTCTGGCACTGGA[C/T]AGCCCTATGGACCTACATTTACAACAGGCGATGTGATTGGCTGCTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086608 Nonsense 269 597 7 14
Genomic Location (Zv9):
Chromosome 2 (position 31534598)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31833505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAATGGTGGCCTCCTATCTGGTTCACCACAGTTACTGTGCCACCGCT[G/T]AGGCCTTTGCCAAATCAACTGACCAGGCTGTACATGAGGAACTTGCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086608 Essential Splice Site 426 597 10 14
Genomic Location (Zv9):
Chromosome 2 (position 31538793)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31837700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCTTGGTGTCCTGAATGGTAGTAGGGGTCAGCAGACGATTGTGAGG[T/A]ATGTATGGCTTTATTTAATATCTTTGGGATTAAATGAGCATTCTGTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link