abcg4a

Ensembl ID:
ENSDARG00000061047
ZFIN ID:
ZDB-GENE-050517-39
Description:
Novel protein similar to vertebrate ATP-binding cassette, sub-family G (WHITE), member 1 (ABCG1) [So
Human Orthologue:
ABCG4
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 4 [Source:HGNC Symbol;Acc:13884]
Mouse Orthologue:
Abcg4
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 4 Gene [Source:MGI Symbol;Acc:MGI:1890594]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40464 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17138 Nonsense Available for shipment Available now
sa33630 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40465 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086610 Essential Splice Site 189 656 5 15
ENSDART00000141444 Essential Splice Site 174 641 5 15

The following transcripts of ENSDARG00000061047 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 32297458)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGCCAACCTTAAACTTAACGAAAATATGGAGGTGAAAAAAGAACTGG[T/C]AAGTGTATACTGTACCTCTATTATCTCTCTATATAATAGGTGAATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086610 Nonsense 214 656 6 15
ENSDART00000141444 Nonsense 199 641 6 15

The following transcripts of ENSDARG00000061047 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 32300257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRGGACTACAGGAGTGTGCCCAAAYTCGCACCRTCTCTCTGTCCGGTGGC[C/T]ARTGTAAACGCTTGGCGATTGCCTTGGAGCTGGTCAACAACCCTCCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086610 Essential Splice Site 238 656 6 15
ENSDART00000141444 Essential Splice Site 223 641 6 15

The following transcripts of ENSDARG00000061047 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 32300331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGCTGGTCAACAACCCTCCAGTCATGTTTTTTGATGAACCCACCAG[G/A]TACACACAGCTTTAACATTACATACTGACACAATTCATCCAGAATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086610 Essential Splice Site 456 656 None 15
ENSDART00000141444 Essential Splice Site 441 641 None 15

The following transcripts of ENSDARG00000061047 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 32308715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGCTGTTTCTCATGTTTGCTGCTCTCATGCCCACCGTCCTAACATG[T/C]AAGTCAACCTACTGGCTTTGCTCAATTCCTCATGAGCATGGAAAATAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link