abcg4a

Ensembl ID:
ENSDARG00000061047
ZFIN ID:
ZDB-GENE-050517-39
Description:
Novel protein similar to vertebrate ATP-binding cassette, sub-family G (WHITE), member 1 (ABCG1) [So
Human Orthologue:
ABCG4
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 4 [Source:HGNC Symbol;Acc:13884]
Mouse Orthologue:
Abcg4
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 4 Gene [Source:MGI Symbol;Acc:MGI:1890594]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17138 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086610 Nonsense 214 656 6 15
ENSDART00000141444 Nonsense 199 641 6 15

The following transcripts of ENSDARG00000061047 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 32300257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRGGACTACAGGAGTGTGCCCAAAYTCGCACCRTCTCTCTGTCCGGTGGC[C/T]ARTGTAAACGCTTGGCGATTGCCTTGGAGCTGGTCAACAACCCTCCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0vdfkhnh