si:dkey-190l1.2

Ensembl ID:
ENSDARG00000061042
ZFIN ID:
ZDB-GENE-060503-620
Description:
gamma-aminobutyric acid type B receptor subunit 2 [Source:RefSeq peptide;Acc:NP_001137515]
Human Orthologue:
GABBR2
Human Description:
gamma-aminobutyric acid (GABA) B receptor, 2 [Source:HGNC Symbol;Acc:4507]
Mouse Orthologue:
Gabbr2
Mouse Description:
gamma-aminobutyric acid (GABA) B receptor, 2 Gene [Source:MGI Symbol;Acc:MGI:2386030]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39253 Nonsense Mutation detected in F1 DNA During 2017
sa43313 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086617 Nonsense 666 935 15 19
Genomic Location (Zv9):
Chromosome 19 (position 36223228)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35087748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCTGTGATGATAAATATTCTTGCCCTTTTCTCTTTGTCTAGTTGTTC[G/T]GATGTTTCTTGGCCTGGGAGACGAGAAACGTGAGCATCCCAGCACTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086617 Nonsense 922 935 19 19
Genomic Location (Zv9):
Chromosome 19 (position 36228054)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35092574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAAGTTGCAGCAGTCCCACAAGCAGCCCATCCTCCAGTCCCCGCCAC[A/T]GACACATGCCTCCCTCCTACAGGGTCATGGTGTCCGGCCTGTGAGCCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link