si:ch1073-351m12.1

Ensembl ID:
ENSDARG00000061040
ZFIN ID:
ZDB-GENE-081031-76
Description:
pumilio homolog 2 [Source:RefSeq peptide;Acc:NP_001096040]
Human Orthologue:
PUM2
Human Description:
pumilio homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:14958]
Mouse Orthologue:
Pum2
Mouse Description:
pumilio 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1931751]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11527 Nonsense Available for shipment Available now
sa43381 Nonsense Mutation detected in F1 DNA During 2017
sa36965 Nonsense Mutation detected in F1 DNA During 2017
sa29304 Nonsense Mutation detected in F1 DNA During 2017
sa36964 Nonsense Available for shipment Available now
sa36963 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 21 1206 1 25
ENSDART00000145964 Nonsense 21 422 2 8
Genomic Location (Zv9):
Chromosome 20 (position 6177428)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6082702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCAGCATCCTAGGTATGAATGACGTACCCTGGCAGGAGACACAATGT[G/T]GAACGCTGCACACCAATGGTGCACCAGAAACTGGTGGGGTCAGAGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 87 1206 1 25
ENSDART00000145964 Nonsense 87 422 2 8
Genomic Location (Zv9):
Chromosome 20 (position 6177230)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6082504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCTGAGTGGTCGTTCACAAGATGATGCCACTGTGGGCTATTTCTTT[C/T]AAAGGCAGCCTGGAGAGCAAATGGGAGGCTGCACTGGCAACAAACACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 185 1206 4 25
ENSDART00000145964 Nonsense 185 422 5 8
Genomic Location (Zv9):
Chromosome 20 (position 6173260)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6078534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTGTGTATAGATCATGCTCTCTCTCAACCCATTATGGTGCAGAAG[C/T]GACCAGGCCAAGGCTACAATGGGACTGGAGAGACGAGCTCAGTGCTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 474 1206 9 25
ENSDART00000145964   None 422 None 8
Genomic Location (Zv9):
Chromosome 20 (position 6160953)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6066317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCAGCTGTAGTTCCGCCCCAGTACTATGGGGTCCCTTGGGGTGTGTA[T/A]CCAGCCAATCTCTTCCAACAACAAGCTACAGCTGCTGCCAGTCATTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 617 1206 12 25
ENSDART00000145964   None 422 None 8
Genomic Location (Zv9):
Chromosome 20 (position 6153948)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6059312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTATGTCTGGTCCTGCTAATGGTCTATACCGGTCCATGGCATGCCAA[C/T]AACCCCAGCAGCCTCAACCTCAGCAGCAGCTTCCTCCACCTTCCAGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086578 Nonsense 1174 1206 25 25
ENSDART00000145964   None 422 None 8
Genomic Location (Zv9):
Chromosome 20 (position 6140207)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6045571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTTGTCAATTCCAGATCCGGCCACATATTGCCACTCTCCGGAAATA[T/G]ACATATGGAAAGCACATCCTGGCTAAGCTGGAAAAGTACTACATGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link