LOC567172

Ensembl ID:
ENSDARG00000061039
Human Orthologue:
ATP10A
Human Description:
ATPase, class V, type 10A [Source:HGNC Symbol;Acc:13542]
Mouse Orthologue:
Atp10a
Mouse Description:
ATPase, class V, type 10A Gene [Source:MGI Symbol;Acc:MGI:1330809]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1779 Essential Splice Site Available for shipment Available now
sa12431 Essential Splice Site Available for shipment Available now
sa6071 Nonsense Mutation detected in F1 DNA During 2014
sa14920 Nonsense Available for shipment Available now
sa5376 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8238 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Essential Splice Site 211 1524 2 21
Genomic Location:
Chromosome 6 (position 38582891)
KASP Assay ID:
554-1772.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAACCAACCTCAAGCAGAGGCAGGTGGTGCGCAGCTTCATCGACCTG[G/A]TAAGTGCTAAGGACWGCAGAGTGTTTGATTTTGAATCCTATAAGTAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Essential Splice Site 319 1524 5 21
Genomic Location:
Chromosome 6 (position 38601424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTGGTGTGTCATCATCCTTTTGGTCATGTGCCTCTTTTCTGCCATTG[G/A]TATGTTACACTTTACATCAATACAGTTCTTGCTGAGTATTGCAAGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Nonsense 997 1524 14 21
Genomic Location:
Chromosome 6 (position 38631103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTRGACAAGAGTTTGGAGGATAAGTTTCTGGCTGTGGCCCGGAGCTG[C/A]AGGTCTGTCCTGTGCTGCCGCTCGACGCCCTTGCAGAAGAGCATGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Nonsense 1104 1524 17 21
Genomic Location:
Chromosome 6 (position 38648071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTCCTGTGTTCTTCCCATCCCAGATGTTTGTYGCCCTGATCTTCTG[G/A]TATCAGTTCTACTGTGGGTTCTCCGGGTCAGCCATGGTGGACCAGTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Essential Splice Site 1190 1524 18 21
Genomic Location:
Chromosome 6 (position 38648825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTGATGCCTTCTACCAAAGYCTCATCTGTTTTTTTATCCCCTACTTTG[T/A]AAGTTTGACTGGTTTTTGTTTTGTTTTTCACATACCATGACTGTTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Nonsense 1505 1524 21 21
Genomic Location:
Chromosome 6 (position 38656423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAAAGCYAAACGACGAGGAGCTTTCAAACCAAAAATCCCTACTAAAA[C/T]AGTCCCAGGACAGGGATCACAGCTGCCTACCRGAACATTCACTCAAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bvy8bfuf