LOC567172

Ensembl ID:
ENSDARG00000061039
Human Orthologue:
ATP10A
Human Description:
ATPase, class V, type 10A [Source:HGNC Symbol;Acc:13542]
Mouse Orthologue:
Atp10a
Mouse Description:
ATPase, class V, type 10A Gene [Source:MGI Symbol;Acc:MGI:1330809]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1779 Essential Splice Site Available for shipment Available now
sa12431 Essential Splice Site Available for shipment Available now
sa33909 Nonsense Mutation detected in F1 DNA During 2016
sa6071 Nonsense Mutation detected in F1 DNA During 2016
sa14920 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Essential Splice Site 211 1524 2 21
Genomic Location (Zv9):
Chromosome 6 (position 38582891)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38654491
KASP Assay ID:
554-1772.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAACCAACCTCAAGCAGAGGCAGGTGGTGCGCAGCTTCATCGACCTG[G/A]TAAGTGCTAAGGACWGCAGAGTGTTTGATTTTGAATCCTATAAGTAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Essential Splice Site 319 1524 5 21
Genomic Location (Zv9):
Chromosome 6 (position 38601424)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38673024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTGGTGTGTCATCATCCTTTTGGTCATGTGCCTCTTTTCTGCCATTG[G/A]TATGTTACACTTTACATCAATACAGTTCTTGCTGAGTATTGCAAGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Nonsense 742 1524 10 21
Genomic Location (Zv9):
Chromosome 6 (position 38610954)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38682554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCGAGCTTCTGCACACCTTGGGGTTTGACTCTACAAGAAAGAGGATGT[C/A]GGTGGTGGTTAAGCATCCGCTGACTGAACAGATCACAGTCTACACTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Nonsense 997 1524 14 21
Genomic Location (Zv9):
Chromosome 6 (position 38631103)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38702703
KASP Assay ID:
554-3958.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTRGACAAGAGTTTGGAGGATAAGTTTCTGGCTGTGGCCCGGAGCTG[C/A]AGGTCTGTCCTGTGCTGCCGCTCGACGCCCTTGCAGAAGAGCATGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086533 Nonsense 1104 1524 17 21
Genomic Location (Zv9):
Chromosome 6 (position 38648071)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38719671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTCCTGTGTTCTTCCCATCCCAGATGTTTGTYGCCCTGATCTTCTG[G/A]TATCAGTTCTACTGTGGGTTCTCCGGGTCAGCCATGGTGGACCAGTGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link