DNER

Ensembl ID:
ENSDARG00000061031
Description:
delta/notch-like EGF repeat containing [Source:HGNC Symbol;Acc:24456]
Human Orthologue:
DNER
Human Description:
delta/notch-like EGF repeat containing [Source:HGNC Symbol;Acc:24456]
Mouse Orthologue:
Dner
Mouse Description:
delta/notch-like EGF-related receptor Gene [Source:MGI Symbol;Acc:MGI:2152889]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14494 Nonsense Available for shipment Available now
sa43177 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2973 Nonsense F2 line generated During 2017
sa5643 Nonsense F2 line generated During 2017
sa43176 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086576 Nonsense 15 688 1 13
Genomic Location (Zv9):
Chromosome 18 (position 45172095)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46764938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAGATGGAGGACAGTCAGAGCACGCAGATGCAGACTCTGGAGCCGTG[G/A]GCTTATATTTGTGTCTGCAGCCGGGGCTTCACAGGGCAGAACTGTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086576 Essential Splice Site 144 688 2 13
Genomic Location (Zv9):
Chromosome 18 (position 45147864)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46740707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGAGCCGGTCAGAGAGTGCTGGAGATACTGTGGGACGATCAGCAGG[T/C]GAGCAGGTGTGCGTCTGCATGCAGAAAGGGATAAGATGATACAGATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2973
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086576 Nonsense 397 688 8 13
ENSDART00000086576 Nonsense 397 688 8 13
Genomic Location (Zv9):
Chromosome 18 (position 45124019)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46716862
KASP Assay ID:
554-3146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGWTCCCTGTGCTTCAGGGCCCTGCCATAATAAYGCCAGCTGCTCYCCA[C/T]AGGGTGCTGGTTTGGGCTWCAGCTGCACTTGTCCTGCAGGTTTCACTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5643
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086576 Nonsense 397 688 8 13
ENSDART00000086576 Nonsense 397 688 8 13
Genomic Location (Zv9):
Chromosome 18 (position 45124019)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46716862
KASP Assay ID:
554-3146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGWTCCCTGTGCTTCAGGGCCCTGCCATAATAAYGCCAGCTGCTCYCCA[C/T]AGGGTGCTGGTTTGGGCTWCAGCTGCACTTGTCCTGCAGGTTTCACTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086576 Essential Splice Site 447 688 8 13
Genomic Location (Zv9):
Chromosome 18 (position 45123867)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46716710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATCTGCCGCAGCATCGGCACTAGTTACCGCTGTCTGTGTGTTCCAGG[T/C]GAGAATCTCGTCTGCTTGCTGCTCAGAGCTCTGTTTCTCCCTTCTGATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link