si:dkey-176m14.1

Ensembl ID:
ENSDARG00000061021
ZFIN ID:
ZDB-GENE-090312-132
Description:
Novel protein similar to vertebrate family with sequence similarity 160, member A1 (FAM160A1) [Sourc
Human Orthologue:
FAM160A1
Human Description:
family with sequence similarity 160, member A1 [Source:HGNC Symbol;Acc:34237]
Mouse Orthologue:
Fam160a1
Mouse Description:
family with sequence similarity 160, member A1 Gene [Source:MGI Symbol;Acc:MGI:2444746]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32678 Nonsense Mutation detected in F1 DNA During 2017
sa32679 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086556 Nonsense 566 974 8 11
Genomic Location (Zv9):
Chromosome 1 (position 23357769)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23810131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCCTCCTCCAGAGGAATACCAGCGCAGCACATTGGATGAAGCAAAT[A/T]GAACTAGGTCATCAGTTGCCACCAGGAAAAAAACTAATTCAGTGTATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086556 Essential Splice Site 910 974 10 11
Genomic Location (Zv9):
Chromosome 1 (position 23364912)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23817274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACAGCCGCTCAGCACTGCCTACTGGCCAGAGAGAGTTCACTAAGAGG[T/G]CAGAGTATGTTTATATCCCTTCAGCCATGTTTCATAAAGACATAGTGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link