LOC557112

Ensembl ID:
ENSDARG00000061020
Human Orthologue:
C10orf118
Human Description:
chromosome 10 open reading frame 118 [Source:HGNC Symbol;Acc:24349]
Mouse Orthologue:
A630007B06Rik
Mouse Description:
RIKEN cDNA A630007B06 gene Gene [Source:MGI Symbol;Acc:MGI:2445022]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42058 Nonsense Mutation detected in F1 DNA During 2016
sa17014 Essential Splice Site Available for shipment Available now
sa35317 Nonsense Mutation detected in F1 DNA During 2016
sa22128 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086570 Nonsense 84 955 1 15
Genomic Location:
Chromosome 12 (position 31948374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAAGACAAGACACGGACATGGAAGTACAGGAAGATGAAGGAGCTGGA[G/T]AACATGCACCGGCTGATGTTAACATTAGCTGTGATAGTGGTACAGCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086570 Essential Splice Site 350 955 3 15
Genomic Location:
Chromosome 12 (position 31954521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGCCATCCAGCAGATGCAGAGGGAGATGGCCTATAGACTCGAACAGG[T/C]GAGAGGTCATCGGCATAGAGACAGTCCAAACATAGATCYGCTTGCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086570 Nonsense 551 955 8 15
Genomic Location:
Chromosome 12 (position 31961186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTAAGGAGTTGGAGGATCTGAAGAGGACTTTTAAAGAAGGCATGGAT[G/T]AACTGACCACCCTGCGGACCAAGGTGGAAACTCATTTCTGATGATTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086570 Nonsense 663 955 10 15
Genomic Location:
Chromosome 12 (position 31966832)
KASP Assay ID:
2260-5536.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAACTGAGCAGTAAAAATGCTCAGCTCCAGTCTGAGAGCAACAGCT[T/G]ACAGGCTCAGCTGGACAGACTGAACAGCAGCTCCAGAGAGCTACACAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link