LOC557112

Ensembl ID:
ENSDARG00000061020
Human Orthologue:
C10orf118
Human Description:
chromosome 10 open reading frame 118 [Source:HGNC Symbol;Acc:24349]
Mouse Orthologue:
A630007B06Rik
Mouse Description:
RIKEN cDNA A630007B06 gene Gene [Source:MGI Symbol;Acc:MGI:2445022]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17014 Essential Splice Site Available for shipment Available now
sa22128 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086570 Essential Splice Site 350 955 3 15
Genomic Location:
Chromosome 12 (position 31954521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGCCATCCAGCAGATGCAGAGGGAGATGGCCTATAGACTCGAACAGG[T/C]GAGAGGTCATCGGCATAGAGACAGTCCAAACATAGATCYGCTTGCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086570 Nonsense 663 955 10 15
Genomic Location:
Chromosome 12 (position 31966832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAACTGAGCAGTAAAAATGCTCAGCTCCAGTCTGAGAGCAACAGCT[T/G]ACAGGCTCAGCTGGACAGACTGAACAGCAGCTCCAGAGAGCTACACAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l76k20vv