LOC571888

Ensembl ID:
ENSDARG00000061014
Human Orthologue:
KCNJ5
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 5 [Source:HGNC Symbol;Acc:6266]
Mouse Orthologue:
Kcnj5
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 5 Gene [Source:MGI Symbol;Acc:MGI:104755]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9146 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086547 Nonsense 127 425 2 3
Genomic Location:
Chromosome 18 (position 47183764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAATTGCACTGATACGAGGAGATCTTCTACACAGCGAYGAGGAGGGCT[G/A]GACCCCCTGCGTTGAAAACCTCAACAGCTTTGTATCCGCTTTCCTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yasli1hf