
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ankfy1
- Ensembl ID:
- ENSDARG00000061013
- ZFIN ID:
- ZDB-GENE-041222-1
- Description:
- ankyrin repeat and FYVE domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001096142]
- Human Orthologue:
- ANKFY1
- Human Description:
- ankyrin repeat and FYVE domain containing 1 [Source:HGNC Symbol;Acc:20763]
- Mouse Orthologue:
- Ankfy1
- Mouse Description:
- ankyrin repeat and FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1337008]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9391 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9391
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086537 | Essential Splice Site | 112 | 1167 | 2 | 24 |
ENSDART00000147874 | Essential Splice Site | 112 | 1166 | 2 | 24 |
- Genomic Location (Zv9):
- Chromosome 5 (position 32641357)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 30402187 GRCz11 5 31002340 - KASP Assay ID:
- 2259-5997.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTGGAGTTTAGCTAACCTGGCTTCCACCTCAGAACTGGACCTCTCAGG[T/G]AACAATTAGGCCTGTCTTGATATCTATKTTTTGTTCTACWATATATTGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: