ankfy1

Ensembl ID:
ENSDARG00000061013
ZFIN ID:
ZDB-GENE-041222-1
Description:
ankyrin repeat and FYVE domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001096142]
Human Orthologue:
ANKFY1
Human Description:
ankyrin repeat and FYVE domain containing 1 [Source:HGNC Symbol;Acc:20763]
Mouse Orthologue:
Ankfy1
Mouse Description:
ankyrin repeat and FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1337008]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9391 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086537 Essential Splice Site 112 1167 2 24
ENSDART00000147874 Essential Splice Site 112 1166 2 24
Genomic Location:
Chromosome 5 (position 32641357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGGAGTTTAGCTAACCTGGCTTCCACCTCAGAACTGGACCTCTCAGG[T/G]AACAATTAGGCCTGTCTTGATATCTATKTTTTGTTCTACWATATATTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gxjscqwc