cyb5d2

Ensembl ID:
ENSDARG00000061006
ZFIN ID:
ZDB-GENE-050506-83
Description:
Neuferricin [Source:UniProtKB/Swiss-Prot;Acc:A2CES0]
Human Orthologue:
CYB5D2
Human Description:
cytochrome b5 domain containing 2 [Source:HGNC Symbol;Acc:28471]
Mouse Orthologue:
Cyb5d2
Mouse Description:
cytochrome b5 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2684848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17246 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086534 Essential Splice Site 100 267 1 4
Genomic Location:
Chromosome 5 (position 32673767)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGGAGAAAGCATTAYGGCCCGGGAGGCGGTTATCATTTCTTTACAGG[T/C]AAGTTTAGTAGGCANNNNNNNTGCTGCTGTGTRGGGGGTTMGGGATGTTAAAGCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0eimo2sa