LOC562395

Ensembl ID:
ENSDARG00000061005
Human Orthologue:
SHKBP1
Human Description:
SH3KBP1 binding protein 1 [Source:HGNC Symbol;Acc:19214]
Mouse Orthologue:
Shkbp1
Mouse Description:
Sh3kbp1 binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2385803]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16084 Essential Splice Site Available for shipment Available now
sa14940 Essential Splice Site Available for shipment Available now
sa10335 Essential Splice Site Available for shipment Available now
sa15252 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086530 Essential Splice Site 16 841 1 20
Genomic Location:
Chromosome 18 (position 47804443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGGCGAGGATTGGAGACATCATTCATCTGAACGTCGGGGGRAAAAGG[T/A]TTGTATTAAGCCTCCATCCTGCTGAGGCAMACRCAGACTTCACTAACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086530 Essential Splice Site 310 841 11 20
Genomic Location:
Chromosome 18 (position 47812929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAAAGCGAGAGGWAACAGTTTCWGATTTTTACACCTCTCTTTCTGCA[G/T]AATCAGGATGTGGTTCCCATCAACAGTTACGACACCGCTGGATCTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086530 Essential Splice Site 339 841 11 20
Genomic Location:
Chromosome 18 (position 47813019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCTTTCCTTATTTTGGGATGCAATAATGGATCTATTTACTACATCGG[T/A]AAAGTGACCAGCAGAGCTGAATAATTGTCAAGTTTTGAGTTAGAAATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086530 Nonsense 457 841 14 20
Genomic Location:
Chromosome 18 (position 47816666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYCACGTGCGCACGTGGACGGTGACGCGCTTCAGAGGCATGATCTCCACT[C/T]AGCCCGGCTCCACTCCGCTGACCTCCTTCAAGATCCTCTCRCTGGAYGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ffls78k7