cox11

Ensembl ID:
ENSDARG00000061004
ZFIN ID:
ZDB-GENE-050506-82
Description:
COX11 homolog, cytochrome c oxidase assembly protein [Source:RefSeq peptide;Acc:NP_001076427]
Human Orthologue:
COX11
Human Description:
COX11 cytochrome c oxidase assembly homolog (yeast) [Source:HGNC Symbol;Acc:2261]
Mouse Orthologue:
Cox11
Mouse Description:
COX11 homolog, cytochrome c oxidase assembly protein (yeast) Gene [Source:MGI Symbol;Acc:MGI:1917052

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9323 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086531 Nonsense 242 259 5 5
Genomic Location:
Chromosome 12 (position 33755865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGATGAAGACCCCCGKATGGCGCGAGTTGATACTATTACACTCTCTTA[T/A]ACCTTTTTTGAAGCCAAAGAGGGACAACATTTACCCCTCCCAGGGTATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gj9e8khy