LOC794258

Ensembl ID:
ENSDARG00000061000
Human Orthologue:
KLHDC8A
Human Description:
kelch domain containing 8A [Source:HGNC Symbol;Acc:25573]
Mouse Orthologue:
Klhdc8a
Mouse Description:
kelch domain containing 8A Gene [Source:MGI Symbol;Acc:MGI:2442630]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21964 Nonsense Available for shipment Available now
sa14268 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086516 Nonsense 59 352 1 5
Genomic Location:
Chromosome 11 (position 39221445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCAGCCCACCAGCGCTCTGGAGCTGTACTCGCCCGAGGTGGACCGCTG[G/A]CTCAGTCTTCCTCCAATGCCCACGCCGAGAGCCGGGGCTGCGGTGGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086516 Nonsense 166 352 2 5
Genomic Location:
Chromosome 11 (position 39216717)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCGCAAGGACGTCTGGGCGCTCCTTCCWGCMATGCCCACCCCGCGCTA[C/A]GATACCAGCATCTGCCTAYTGGGCTCCAAGATCTAYGTGGCAGGTTTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uo8guhvi