atp2a3

Ensembl ID:
ENSDARG00000060978
ZFIN ID:
ZDB-GENE-060531-103
Description:
Novel protein similar to vertebrate ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 (ATP2A1
Human Orthologue:
ATP2A3
Human Description:
ATPase, Ca++ transporting, ubiquitous [Source:HGNC Symbol;Acc:813]
Mouse Orthologue:
Atp2a3
Mouse Description:
ATPase, Ca++ transporting, ubiquitous Gene [Source:MGI Symbol;Acc:MGI:1194503]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33633 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12264 Essential Splice Site Available for shipment Available now
sa11614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 Essential Splice Site 211 849 3 16
ENSDART00000133432 Essential Splice Site 292 932 5 18
Genomic Location (Zv9):
Chromosome 5 (position 32868758)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30630990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGACAAGACTGGGACCCTGACAACCAACCAGATGTCTGTCTGCAGG[G/A]TAAGTGATGTGGCTGTTCCAGCTAGACACAGAGATGCTGTCTCATTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 Essential Splice Site 319 849 6 16
ENSDART00000133432 Essential Splice Site 400 932 8 18
Genomic Location (Zv9):
Chromosome 5 (position 32883885)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30646117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTATCTGGACTCAGTAAAGTGGACAGAGCTGCAGCTTGCAACTTGG[T/A]AAGAAAGAGCCACAGGGTGCAGGAGGATATGAGACCRACTGMAATAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 Nonsense 594 849 10 16
ENSDART00000133432 Nonsense 675 932 12 18
Genomic Location (Zv9):
Chromosome 5 (position 32893728)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30655960
KASP Assay ID:
2259-6004.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTCTGATGATAACTTCTCCACCATCGTGGCYGCCGTGGAAGAGGGA[C/T]GAGCTATCTATAACAACATGAAGCAGTTYATTCGTTAWCTCATCTCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link