atp2a3

Ensembl ID:
ENSDARG00000060978
ZFIN ID:
ZDB-GENE-060531-103
Description:
Novel protein similar to vertebrate ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 (ATP2A1
Human Orthologue:
ATP2A3
Human Description:
ATPase, Ca++ transporting, ubiquitous [Source:HGNC Symbol;Acc:813]
Mouse Orthologue:
Atp2a3
Mouse Description:
ATPase, Ca++ transporting, ubiquitous Gene [Source:MGI Symbol;Acc:MGI:1194503]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8192 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12264 Essential Splice Site Available for shipment Available now
sa3530 Nonsense Mutation detected in F1 DNA During 2014
sa11614 Nonsense Available for shipment Available now
sa3535 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 None None 849 None 16
ENSDART00000133432 Essential Splice Site 35 932 1 18
Genomic Location:
Chromosome 5 (position 32852061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCATCTTGCTCATTCTGGTGGCCAACGCAGTCATTGGAGTCTGGCAG[G/A]TGGGTGTGGGTGTGTGTNGGGGGGCCATGTAGAAATTCAACAAATGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 Essential Splice Site 319 849 6 16
ENSDART00000133432 Essential Splice Site 400 932 8 18
Genomic Location:
Chromosome 5 (position 32883885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTATCTGGACTCAGTAAAGTGGACAGAGCTGCAGCTTGCAACTTGG[T/A]AAGAAAGAGCCACAGGGTGCAGGAGGATATGAGACCRACTGMAATAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 Nonsense 511 849 9 16
ENSDART00000133432 Nonsense 592 932 11 18
Genomic Location:
Chromosome 5 (position 32891498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGTACACTGGCAGAGAGTTTGATGATCTYGCTCCAGAAGCCCAGCGA[G/T]AGGCAGTGAAGAGRGCAAGATGCTTCGCCAGAGTSGAACCTGCGCACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 Nonsense 594 849 10 16
ENSDART00000133432 Nonsense 675 932 12 18
Genomic Location:
Chromosome 5 (position 32893728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTCTGATGATAACTTCTCCACCATCGTGGCYGCCGTGGAAGAGGGA[C/T]GAGCTATCTATAACAACATGAAGCAGTTYATTCGTTAWCTCATCTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086443 Nonsense 606 849 10 16
ENSDART00000133432 Nonsense 687 932 12 18
Genomic Location:
Chromosome 5 (position 32893766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAAGAGGGACGAGCTATCTATAACAACATGAAGCAGTTYATTCGTTA[T/A]CTCATCTCCTCCAACGTGGGAGAGGTGGTGTGGTGAGTAGTGCAGCGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sfttenus