CREBBP (3 of 3)

Ensembl ID:
ENSDARG00000060976
Description:
CREB binding protein [Source:HGNC Symbol;Acc:2348]
Human Orthologue:
CREBBP
Human Description:
CREB binding protein [Source:HGNC Symbol;Acc:2348]
Mouse Orthologue:
Crebbp
Mouse Description:
CREB binding protein Gene [Source:MGI Symbol;Acc:MGI:1098280]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40001 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091863 Nonsense 334 838 6 20
ENSDART00000115164 Nonsense 348 1660 6 26
Genomic Location (Zv9):
Chromosome 3 (position 9877369)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 9683800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGTCCAGTACTAACAGCTCCACTCCAGCCAACCAGTCTGCTCAGTCA[C/T]GAAAGAAAAGTAAAAGCTTAACCCTGAACTACATTTAACAGTATACAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link