LOC560613

Ensembl ID:
ENSDARG00000060951
Human Orthologue:
POLG
Human Description:
polymerase (DNA directed), gamma [Source:HGNC Symbol;Acc:9179]
Mouse Orthologue:
Polg
Mouse Description:
polymerase (DNA directed), gamma Gene [Source:MGI Symbol;Acc:MGI:1196389]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9574 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086397 Nonsense 1200 1206 22 22
Genomic Location:
Chromosome 25 (position 8686948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTTATCAGATTATAGAGATCACCAAGGGCTCGCTGACCAAAGAAAAA[C/T]GACAAGCTCCAAGGTCAAAATAACATCTGTGGGATGAGCGGCTCTCAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Common variants in the GDF5-UQCC region are associated with variation in human height. (View Study)
  • Menopause (age at onset): Meta-analyses identify 13 loci associated with age at menopause and highlight DNA repair and immune pathways. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p8ykqjkv