pip5kl1

Ensembl ID:
ENSDARG00000060946
ZFIN ID:
ZDB-GENE-060526-248
Description:
Novel protein similar to human and mouse phosphatidylinositol-4-phosphate 5-kinase-like 1 (PIP5KL1)
Human Orthologue:
PIP5KL1
Human Description:
phosphatidylinositol-4-phosphate 5-kinase-like 1 [Source:HGNC Symbol;Acc:28711]
Mouse Orthologue:
Pip5kl1
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2448520]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14783 Essential Splice Site Available for shipment Available now
sa20459 Nonsense Available for shipment Available now
sa20458 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086407 Essential Splice Site 73 394 2 11
ENSDART00000141328 Essential Splice Site 65 285 1 8
Genomic Location (Zv9):
Chromosome 5 (position 33347398)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31109630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGGGCTGCGTGCTGCTGTGCAGAACACCATTGWCAACCCTTTACCTG[T/C]GAGTATACACAWGTTTATGAGCTCACACCTCCAATCCCTAGAGAATATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086407 Nonsense 118 394 4 11
ENSDART00000141328 Nonsense 110 285 3 8
Genomic Location (Zv9):
Chromosome 5 (position 33340983)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31103215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGCAAGTCTGCGTCGTTCTTTGGGAATGACGGAGAAGGAGTATCAG[C/T]AGTCGCTCTCCTCTGAAGGCTGTTACCTGCAATTCATCAGCAACTCTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086407 Essential Splice Site 196 394 7 11
ENSDART00000141328 Essential Splice Site 188 285 6 8
Genomic Location (Zv9):
Chromosome 5 (position 33338053)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31100285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCGATTATATCACGAACCCTGAAAGCTGTATTGATGTTTTGTATGCA[G/A]AAGTACTTTATTGTGATGCAAAGTGTCTTTTACCCTGATGACAGAATCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link