si:ch211-208c9.4

Ensembl ID:
ENSDARG00000060944
ZFIN ID:
ZDB-GENE-060503-400
Description:
hypothetical protein LOC567287 [Source:RefSeq peptide;Acc:NP_001076322]
Human Orthologue:
RNF217
Human Description:
ring finger protein 217 [Source:HGNC Symbol;Acc:21487]
Mouse Orthologue:
Rnf217
Mouse Description:
ring finger protein 217 Gene [Source:MGI Symbol;Acc:MGI:3610311]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43507 Nonsense Mutation detected in F1 DNA During 2017
sa23784 Nonsense Available for shipment Available now
sa10934 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086405 Nonsense 58 543 1 6
ENSDART00000098253 Nonsense 58 524 1 6
Genomic Location (Zv9):
Chromosome 20 (position 39814499)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39886155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCCGCAGCGGTGAGGCGAAGGTGCCGTCATCGTCATCATTATCCTCG[A/T]AGGATGTTTTGGAATTTCATAAACACAAACATGGACCAGGAGGCGGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086405 Nonsense 159 543 1 6
ENSDART00000098253 Nonsense 159 524 1 6
Genomic Location (Zv9):
Chromosome 20 (position 39814195)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39885851
KASP Assay ID:
2261-4783.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATTGGGAAATCCTGATGGGAATCATCATATTGATTATAACATTGATT[T/A]GAAGAGTGGCGAAGATCCCAGCCAATCAAAAGAGCATGTTTACTGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086405 Nonsense 485 543 4 6
ENSDART00000098253 Nonsense 485 524 4 6
Genomic Location (Zv9):
Chromosome 20 (position 39785568)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39857224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTGTGTTTGGATGCAAATACCGCTACCTGCCAGAGAAACCGCAYCTA[C/T]GACGGCTGGTCCGAGGCTCCGTCTGCAGTAAGTGGACATTCAGNNNNNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link