LOC572369

Ensembl ID:
ENSDARG00000060939
Human Orthologue:
KIRREL3
Human Description:
kin of IRRE like 3 (Drosophila) [Source:HGNC Symbol;Acc:23204]
Mouse Orthologue:
Kirrel3
Mouse Description:
kin of IRRE like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914953]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23385 Nonsense Mutation detected in F1 DNA During 2016
sa1632 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa23385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086379 Nonsense 35 525 2 10
Genomic Location (Zv9):
Chromosome 18 (position 46016779)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 47826252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCTGAAAAGATGTATCATTGTTCCTCTCTATCTACTGTTTACAGGTG[G/A]GCAAAAGGAGGAAGTGTGATAAAGGAAGTGTCAGGAGACACTTACGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1632
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086379 Essential Splice Site 268 525 6 10
Genomic Location (Zv9):
Chromosome 18 (position 45986888)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 47796361
KASP Assay ID:
554-1573.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAACAGCTTTGGCTCCGATACTGAGATCATTCGCCTCAAGGAACAAG[G/A]TGGGAGCCAAGGTTCGCCAGGTTTCACCTTCTTTTCTTTAAAGCACGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link