LOC572369

Ensembl ID:
ENSDARG00000060939
Human Orthologue:
KIRREL3
Human Description:
kin of IRRE like 3 (Drosophila) [Source:HGNC Symbol;Acc:23204]
Mouse Orthologue:
Kirrel3
Mouse Description:
kin of IRRE like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914953]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23385 Nonsense Mutation detected in F1 DNA During 2014
sa1632 Essential Splice Site F2 line generated During 2014
sa4027 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086379 Nonsense 35 525 2 10
Genomic Location:
Chromosome 18 (position 46016779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCTGAAAAGATGTATCATTGTTCCTCTCTATCTACTGTTTACAGGTG[G/A]GCAAAAGGAGGAAGTGTGATAAAGGAAGTGTCAGGAGACACTTACGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1632
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086379 Essential Splice Site 268 525 6 10
Genomic Location:
Chromosome 18 (position 45986888)
KASP Assay ID:
554-1573.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAACAGCTTTGGCTCCGATACTGAGATCATTCGCCTCAAGGAACAAG[G/A]TGGGAGCCAAGGTTCGCCAGGTTTCACCTTCTTTTCTTTAAAGCACGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086379 Essential Splice Site 305 525 8 10
Genomic Location:
Chromosome 18 (position 45978737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTACACTTGAYTATACTTGATTGTACTAACATTCACCTCTTTCCTCTC[A/T]GAYCTCAAAGGTGTGGTATCAGCCAAGAACGACATCCGCRTGGAAATCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0l7hckza